LabMart Knowledge Center
Schedule a meeting
+233302452966
My Account
My Orders
My Wishlist (
0
)
LabMart Knowledge Center
Schedule a meeting
+233302452966
My Account
My Orders
My Wishlist (
0
)
All Products
View All Products
View All Products
Agricultural Research products
Autoclaving & Sterilization
Books & Reference Materials
Centrifuges and Microcentrifuges
Chemicals
Chromatography
Basic Science Laboratory Products
Cold Storage Products
Desiccation and Evaporation
Filters and Filtration
Laboratory Ventilation
Laboratory Equipment and Instruments
Personal Protective Equipment
Medical Supplies
Industrial Instruments
Life Sciences
Testing and Filtration
Glassware & Plasticware
Agricultural Research products
Agricultural Research products
Autoclaving & Sterilization
Autoclaving & Sterilization
Autoclave Bags
Glassware Washers and Dryers
Sterilization Verification Indicators
Sterilizer and Autoclave Accessories
Centrifuges and Microcentrifuges
Centrifuges and Microcentrifuges
Benchtop Centrifuges
Centrifuge Accessories
Centrifuge Tubes and Bottles
Floor Model Centrifuges
Microcentrifuges
Chemicals
Chemicals
Analytical and Chromatography Solvents
Biochemicals and Diagnostics
Biomedical Polymers
Buffers and Solutions
Organic compounds
Salts and Inorganics
Certified Reference Materials
Chromatography and Mass Spectrometry Reagents
Resins and Supports
Life Science Chemicals
Chromatography
Chromatography
Autosamplers and Injectors
Autosampler Vial Crimpers and Decappers
Autosampler Vials, Caps, and Closures
Chromatography Fittings & Tools
Chromatography Columns and Cartridges
Chromatography Instruments
Chromatography Syringes
Ion Chromatography
Solid Phase Extraction (SPE)
Thin Layer Chromatography
Basic Science Laboratory Products
Basic Science Laboratory Products
Biology Classroom
Chemistry Classroom
Patient Care Simulators
Physics Classroom
Cold Storage Products
Cold Storage Products
Cryogenic Storage Solutions
Freezers
Refrigerator and Freezer Accessories
Refrigerators
Desiccation and Evaporation
Desiccation and Evaporation
Desiccants and Drying Agents
Desiccators
Evaporators
Freeze Drying Chambers and Equipment
Glass Drying Tubes
Filters and Filtration
Filters and Filtration
Bottle Tops and Filter Units
Extraction Thimbles
Filter Holders and Hardware
Filtering Funnels
Filter Paper
Glass Fiber Filters and Prefilters
Membranes for Filtration
Syringe and Syringeless Filters
Laboratory Ventilation
Laboratory Ventilation
Biological Safety Cabinets
Laboratory Hoods and Enclosures
Laboratory Equipment and Instruments
Laboratory Equipment and Instruments
Balances, Scales and Weighing
Baths
Burners and Lighters
Furnaces
Heaters and Heating Mantles
Hotplates and Hotplate Stirrers
Incubators, Hot Plates, Baths and Heating
Extraction Systems
Melting Point Apparatus
Mixers, Shakers and Stirrers
Pumps
Recirculating Chillers
Spatulas, Forceps and Utensils
Thermometers, Timers and pH Meters
Viscometers
Spectrophotometers, Refractometers and Benchtop Instruments
Extraction Systems
Extraction Systems
Personal Protective Equipment
Personal Protective Equipment
Eyewashes and Showers
First Aid Products
Hand Protection
Lab Coats, Aprons and Apparel
Laboratory Wipes, Cleaners, and Disinfectants
Industrial Instruments
Industrial Instruments
Industrial Scales and Balances
Life Sciences
Life Sciences
Antibodies
Cell Analysis
Electrophoresis, Western Blotting and ELISA
Enzymes and Inhibitors
Microbiology
Cell & Tissue Culture
Molecular Biology, Reagents and Kits
Liquid Handling
Protein Analysis Reagents
Sealing Films, Foils & Tapes
Life Science Buffers
Microarray Scanners and Accessories
Genetic Analysis
Glassware & Plasticware
Glassware & Plasticware
Transfection & Cloning
Transfection & Cloning
Log in
|
Sign Up
0
0
My Account
My Orders
My Wishlist (
0
)
Password Reset
Logout
All Products
Menu
View All Products
Agricultural Research products
Autoclaving & Sterilization
Books & Reference Materials
Centrifuges and Microcentrifuges
Chemicals
Chromatography
Basic Science Laboratory Products
Cold Storage Products
Desiccation and Evaporation
Filters and Filtration
Laboratory Ventilation
Laboratory Equipment and Instruments
Personal Protective Equipment
Medical Supplies
Industrial Instruments
Life Sciences
Testing and Filtration
Glassware & Plasticware
Agricultural Research products
Autoclaving & Sterilization
Autoclave Bags
Glassware Washers and Dryers
Sterilization Verification Indicators
Sterilizer and Autoclave Accessories
Centrifuges and Microcentrifuges
Benchtop Centrifuges
Centrifuge Accessories
Centrifuge Tubes and Bottles
Floor Model Centrifuges
Microcentrifuges
Chemicals
Analytical and Chromatography Solvents
Biochemicals and Diagnostics
Biomedical Polymers
Buffers and Solutions
Organic compounds
Salts and Inorganics
Certified Reference Materials
Chromatography and Mass Spectrometry Reagents
Resins and Supports
Life Science Chemicals
Chromatography
Autosamplers and Injectors
Autosampler Vial Crimpers and Decappers
Autosampler Vials, Caps, and Closures
Chromatography Fittings & Tools
Chromatography Columns and Cartridges
Chromatography Instruments
Chromatography Syringes
Ion Chromatography
Solid Phase Extraction (SPE)
Thin Layer Chromatography
Basic Science Laboratory Products
Biology Classroom
Chemistry Classroom
Patient Care Simulators
Physics Classroom
Cold Storage Products
Cryogenic Storage Solutions
Freezers
Refrigerator and Freezer Accessories
Refrigerators
Desiccation and Evaporation
Desiccants and Drying Agents
Desiccators
Evaporators
Freeze Drying Chambers and Equipment
Glass Drying Tubes
Filters and Filtration
Bottle Tops and Filter Units
Extraction Thimbles
Filter Holders and Hardware
Filtering Funnels
Filter Paper
Glass Fiber Filters and Prefilters
Membranes for Filtration
Syringe and Syringeless Filters
Laboratory Ventilation
Biological Safety Cabinets
Laboratory Hoods and Enclosures
Laboratory Equipment and Instruments
Balances, Scales and Weighing
Baths
Burners and Lighters
Furnaces
Heaters and Heating Mantles
Hotplates and Hotplate Stirrers
Incubators, Hot Plates, Baths and Heating
Extraction Systems
Melting Point Apparatus
Mixers, Shakers and Stirrers
Pumps
Recirculating Chillers
Spatulas, Forceps and Utensils
Thermometers, Timers and pH Meters
Viscometers
Spectrophotometers, Refractometers and Benchtop Instruments
Extraction Systems
Personal Protective Equipment
Eyewashes and Showers
First Aid Products
Hand Protection
Lab Coats, Aprons and Apparel
Laboratory Wipes, Cleaners, and Disinfectants
Industrial Instruments
Industrial Scales and Balances
Life Sciences
Antibodies
Cell Analysis
Electrophoresis, Western Blotting and ELISA
Enzymes and Inhibitors
Microbiology
Cell & Tissue Culture
Molecular Biology, Reagents and Kits
Liquid Handling
Protein Analysis Reagents
Sealing Films, Foils & Tapes
Life Science Buffers
Microarray Scanners and Accessories
Genetic Analysis
Glassware & Plasticware
Transfection & Cloning
首页
商店
约会
联系我们
0
0
+1 (650) 555-0111
登录
联系我们
0
0
首页
商店
约会
联系我们
+1 (650) 555-0111
登录
联系我们
5627 RESULTS FOR “”
Filters
In-Stock
In-Stock
Application
Grade
Laboratory grade
Analytical grade
Brand
VWR
Description
product.attribute(14,) product.attribute.value(471,)
15mL, 25/Pk
product.attribute(14,) product.attribute.value(472,)
50mL, 25/Pk
product.attribute(14,) product.attribute.value(473,) product.attribute(14,) product.attribute.value(474,) product.attribute(14,) product.attribute.value(494,)
With Filter cap, 25cm2
product.attribute(14,) product.attribute.value(495,)
With Filter Cap, 75cm2
product.attribute(14,) product.attribute.value(496,)
With Filter Cap, 175cm2
product.attribute(14,) product.attribute.value(497,)
With plugged Cap, 25cm2
product.attribute(14,) product.attribute.value(498,)
With plugged Cap, 75cm2
product.attribute(14,) product.attribute.value(499,)
With plugged Cap, 175cm2
product.attribute(14,) product.attribute.value(541,) product.attribute(14,) product.attribute.value(641,) product.attribute(14,) product.attribute.value(642,) product.attribute(14,) product.attribute.value(643,) product.attribute(14,) product.attribute.value(664,)
5 x 100 mL
product.attribute(14,) product.attribute.value(665,)
10 x 50 mL
product.attribute(14,) product.attribute.value(666,)
1 x 100 mL
product.attribute(14,) product.attribute.value(667,)
1 x 500 mL
product.attribute(14,) product.attribute.value(668,)
1 x 1,000 mL
product.attribute(14,) product.attribute.value(669,)
4 x 1,000 mL
product.attribute(14,) product.attribute.value(803,)
30 mL with Patient ID Label for Urine Sample
product.attribute(14,) product.attribute.value(804,)
30 mL with Spoon & Patient ID Label for Stool Sample
product.attribute(14,) product.attribute.value(805,)
60 mL with Patient ID Label for Urine Sample
product.attribute(14,) product.attribute.value(806,) product.attribute(14,) product.attribute.value(807,)
100 mL for gnerel purpose
product.attribute(14,) product.attribute.value(808,)
120 mL for gnerel purpose
product.attribute(14,) product.attribute.value(816,)
Single Frosted End
product.attribute(14,) product.attribute.value(817,)
Double Frosted End
product.attribute(14,) product.attribute.value(818,)
Plain, Non Frosted
product.attribute(14,) product.attribute.value(1800,)
Vortex-Genie® 1, Speed range: 2700 fixed
product.attribute(14,) product.attribute.value(1801,)
Vortex-Genie® 2, Speed range: 600 - 2700
product.attribute(14,) product.attribute.value(1802,)
Vortex-Genie® 2T, Speed range: 600 - 2700, With timer function; touch-on 1 to 60 seconds, hands-free 1 to 60 minutes or continuous
product.attribute(14,) product.attribute.value(1828,) product.attribute(14,) product.attribute.value(1829,) product.attribute(14,) product.attribute.value(1830,) product.attribute(14,) product.attribute.value(1831,) product.attribute(14,) product.attribute.value(562,)
Full body
product.attribute(14,) product.attribute.value(1369,)
Round tip, 180mm
product.attribute(14,) product.attribute.value(3207,)
SYTO 12 Green Fluorescent Nucleic Acid Stain, 4 mM Solution in DMSO, 315 µL
product.attribute(14,) product.attribute.value(563,)
Half Body
product.attribute(14,) product.attribute.value(1370,)
Round tip, 125mm
product.attribute(14,) product.attribute.value(3208,)
SYTO 13 Green Fluorescent Nucleic Acid Stain, 5 mM Solution in DMSO, 250 µL
product.attribute(14,) product.attribute.value(3320,)
Gel Percentage: 1%; Separation Range: 100 to 5000 bp, 10 Gels/Pk.
product.attribute(14,) product.attribute.value(3321,)
Gel Percentage: 1%; Separation Range: 100 to 5000 bp, 20 Gels/Pk.
product.attribute(14,) product.attribute.value(3322,)
Gel Percentage: 2%; Separation Range: 50 to 2000 bp, 10 Gels/Pk.
product.attribute(14,) product.attribute.value(3323,)
Gel Percentage: 2%; Separation Range: 50 to 2000 bp, 20 Gels/Pk.
product.attribute(14,) product.attribute.value(3324,)
Gel Percentage: 4%; Separation Range: 20 to 800 bp, 10 Gels/Pk.
product.attribute(14,) product.attribute.value(5022,)
Plugged-Seal Cap, 15 mL, Racked, 25/Pk
product.attribute(14,) product.attribute.value(5023,)
Plugged-Seal Cap, 50 mL, Racked, 25/Pk
product.attribute(14,) product.attribute.value(5024,)
Flat Top Cap, 15mL, Racked, 25/Pk
product.attribute(14,) product.attribute.value(5025,)
Flat Top Cap, 50 mL, Racked, 25/Pk
product.attribute(14,) product.attribute.value(5026,)
Flat Top Cap, 15mL, Bulk packed, 25/Pk
product.attribute(14,) product.attribute.value(5027,)
Flat Top Cap, 50 mL, Bulk packed, 25/Pk
product.attribute(14,) product.attribute.value(568,) product.attribute(14,) product.attribute.value(1581,)
pH 1.00, Colourless, Glycine, 1000mL
product.attribute(14,) product.attribute.value(3209,)
SYTO 14 Green Fluorescent Nucleic Acid Stain, 5 mM Solution in DMSO, 250 µL
product.attribute(14,) product.attribute.value(569,) product.attribute(14,) product.attribute.value(1582,)
pH 2.00, Colourless, Citrate, 500mL
product.attribute(14,) product.attribute.value(3210,)
SYTO 16 Green Fluorescent Nucleic Acid Stain, 1 mM Solution in DMSO, 250 µL
product.attribute(14,) product.attribute.value(659,) product.attribute(14,) product.attribute.value(1583,)
pH 2.00, Colourless, Citrate, 1000mL
product.attribute(14,) product.attribute.value(3211,)
SYTO 21 Green Fluorescent Nucleic Acid Stain, 5 mM Solution in DMSO, 250 µL
product.attribute(14,) product.attribute.value(660,) product.attribute(14,) product.attribute.value(1584,)
pH 3.00, Colourless, Citrate, 1000mL
product.attribute(14,) product.attribute.value(3212,)
SYTO 24 Green Fluorescent Nucleic Acid Stain, 5 mM Solution in DMSO, 250 µL
product.attribute(14,) product.attribute.value(661,) product.attribute(14,) product.attribute.value(1585,)
pH 4.66, Colourless, Acetate, 500mL
product.attribute(14,) product.attribute.value(3213,)
SYTO BC Green Fluorescent Nucleic Acid Stain, 100 µL
product.attribute(14,) product.attribute.value(662,) product.attribute(14,) product.attribute.value(1586,)
pH 4.66, Colourless, Acetate, 1000mL
product.attribute(14,) product.attribute.value(3214,)
SYTO RNASelect Green Fluorescent Cell Stain, 5 mM Solution in DMSO, 100 µL
product.attribute(14,) product.attribute.value(663,) product.attribute(14,) product.attribute.value(1587,)
pH 5.00, Colourless, Citrate, 1000mL
product.attribute(14,) product.attribute.value(3215,)
1 kit SYTO Green Fluorescent Nucleic Acid Stain Sampler Kit #1: SYTO dyes 11, 14, 16, 21, 24 (50 μL each)
product.attribute(14,) product.attribute.value(873,) product.attribute(14,) product.attribute.value(1588,)
pH 6.00, Colourless, Citrate, 1000mL
product.attribute(14,) product.attribute.value(874,) product.attribute(14,) product.attribute.value(1589,)
pH 6.88, Colourless, Phosphate, 1000mL
product.attribute(14,) product.attribute.value(878,)
PTFE coated needles, 76mm long
product.attribute(14,) product.attribute.value(1590,)
pH 6.88, Colourless, Phosphate, 500mL
product.attribute(14,) product.attribute.value(875,) product.attribute(14,) product.attribute.value(1591,)
pH 7.00, Colourless, Phosphate, 1000mL
product.attribute(14,) product.attribute.value(876,)
Needles, 76mm long
product.attribute(14,) product.attribute.value(1592,)
pH 8.00, Colourless, Borate, 1000mL
product.attribute(14,) product.attribute.value(877,)
needles, 127mm long
product.attribute(14,) product.attribute.value(1784,)
CoolCell® LX, exposed tops for 12 standard 1.0 mL to 2.0 mL cryogenic vials, Purple
product.attribute(14,) product.attribute.value(879,)
PTFE coated needles, 127mm long
product.attribute(14,) product.attribute.value(1785,)
CoolCell® LX, exposed tops for 12 standard 1.0 mL to 2.0 mL cryogenic vials, Green
product.attribute(14,) product.attribute.value(1144,)
Used for 30 , 35 , 50L container , with 4 castors
product.attribute(14,) product.attribute.value(1786,)
CoolCell® LX, exposed tops for 12 standard 1.0 mL to 2.0 mL cryogenic vials, Orange
product.attribute(14,) product.attribute.value(1145,)
Used for 47L container , with 4 castors
product.attribute(14,) product.attribute.value(1787,)
CoolCell® LX, exposed tops for 12 standard 1.0 mL to 2.0 mL cryogenic vials, Pink
product.attribute(14,) product.attribute.value(1146,)
Used for 65~175L container , with 4 Castors
product.attribute(14,) product.attribute.value(1788,)
CoolCell® LX, exposed tops for 12 standard 1.0 mL to 2.0 mL cryogenic vials (each one purple, orange, green and pink), Assorted colours, 4/pk
product.attribute(14,) product.attribute.value(1298,)
For 15mL Centrifuge Tubes, 25-Well
product.attribute(14,) product.attribute.value(1789,)
CoolCell® FTS30, exposed tops for 30x1 ml or 2 ml cryogenic vials, Purple
product.attribute(14,) product.attribute.value(1299,)
For 50 mL Centrifuge Tubes, 25-Well
product.attribute(14,) product.attribute.value(1790,)
CoolCell® FTS30, exposed tops for 30x1 ml or 2 ml cryogenic vials, Orange
product.attribute(14,) product.attribute.value(1322,)
Round tips, 150mm
product.attribute(14,) product.attribute.value(1791,)
CoolCell® FTS30, exposed tops for 30x1 ml or 2 ml cryogenic vials, Green
product.attribute(14,) product.attribute.value(1323,)
Fine tip, 120mm
product.attribute(14,) product.attribute.value(1792,)
CoolCell® FTS30, exposed tops for 30x1 ml or 2 ml cryogenic vials, Pink
product.attribute(14,) product.attribute.value(1324,)
Round tip, 200mm
product.attribute(14,) product.attribute.value(1793,)
CoolCell® 5 ml LX, exposed tops for 12x3.5 mL to 5 mL cryogenic vials, Purple
product.attribute(14,) product.attribute.value(1328,)
Milk, 0-20%
product.attribute(14,) product.attribute.value(1794,)
CoolCell® SV10, exposed tops for 6 standard 10.0 mL injectable ampules, Purple
product.attribute(14,) product.attribute.value(1329,)
Salinity, 0 - 100%
product.attribute(14,) product.attribute.value(1795,)
CoolCell® SV2, exposed tops for 12 standard 2.0 mL injectable ampules, Purple
product.attribute(14,) product.attribute.value(1330,)
Sugar, 0-80%
product.attribute(14,) product.attribute.value(1966,)
Now Wash your Hands, 300x100mm
product.attribute(14,) product.attribute.value(1331,)
Sodium Chloride, 0-28%
product.attribute(14,) product.attribute.value(1967,)
Eye Protection must be worn in area, 300x100mm
product.attribute(14,) product.attribute.value(1332,)
Alcohol, 0 - 80%
product.attribute(14,) product.attribute.value(1968,)
Protective gloves must be worn, 300x100mm
product.attribute(14,) product.attribute.value(1367,)
140mm
product.attribute(14,) product.attribute.value(1969,)
Protective clothing must be worn, 300x100mm
product.attribute(14,) product.attribute.value(1368,)
160mm
product.attribute(14,) product.attribute.value(1970,)
Wear Face Mask, 300x100mm
product.attribute(14,) product.attribute.value(1531,)
UV to white light converter screen, 200×200 mm
product.attribute(14,) product.attribute.value(1971,)
First Aid, 200x300mm
product.attribute(14,) product.attribute.value(1532,)
UV to blue light conversion screen 210×260 mm
product.attribute(14,) product.attribute.value(1560,) product.attribute(14,) product.attribute.value(1561,) product.attribute(14,) product.attribute.value(1603,)
60 mL, Clear, Certified
product.attribute(14,) product.attribute.value(1604,)
120 mL, Amber, Certified
product.attribute(14,) product.attribute.value(1605,)
125 mL, Clear, Certified
product.attribute(14,) product.attribute.value(1607,)
for Flasks and Bottles
product.attribute(14,) product.attribute.value(199,)
Socket 24/29, cone 19/26, thimble size: 18×55 mm, 20 ml
product.attribute(14,) product.attribute.value(200,)
Socket 29/32, cone 24/29, thimble size: 22×80 mm, 40 ml
product.attribute(14,) product.attribute.value(201,)
Socket 34/35, cone 24/29, thimble size: 28×80 mm, 60 ml
product.attribute(14,) product.attribute.value(202,)
Socket 34/35, cone 34/35, thimble size: 28×120 mm, 100 ml
product.attribute(14,) product.attribute.value(203,)
Socket 40/38, cone 24/29, thimble size: 33×100 mm, 100 ml
product.attribute(14,) product.attribute.value(204,)
Socket 50/42, cone 24/29, thimble size: 41×123 mm, 200 ml
product.attribute(14,) product.attribute.value(234,)
With standard penetration probe
product.attribute(14,) product.attribute.value(235,)
Without Probe
product.attribute(14,) product.attribute.value(258,)
With -40℃ ~ + 120℃ sensor probe
product.attribute(14,) product.attribute.value(259,)
With PT 100 sensor -200°C ~ +150°C for Cryogenic freezers
product.attribute(14,) product.attribute.value(260,) product.attribute(14,) product.attribute.value(266,)
Clear, 25 mL
product.attribute(14,) product.attribute.value(267,)
Clear, 10 mL
product.attribute(14,) product.attribute.value(268,)
Clear, 50 mL
product.attribute(14,) product.attribute.value(269,)
Amber, 25 mL
product.attribute(14,) product.attribute.value(270,)
Amber, 10 mL
product.attribute(14,) product.attribute.value(271,)
Amber, 50 mL
product.attribute(14,) product.attribute.value(272,)
pH 7.0, Colourless, 500mL
product.attribute(14,) product.attribute.value(273,)
pH 9.0, Blue, 500mL
product.attribute(14,) product.attribute.value(274,)
pH 4.0, Red, 500mL
product.attribute(14,) product.attribute.value(275,)
pH 10.0, Colourless, 500mL
product.attribute(14,) product.attribute.value(321,) product.attribute(14,) product.attribute.value(322,) product.attribute(14,) product.attribute.value(323,) product.attribute(14,) product.attribute.value(354,)
10µl, box of 960 Tips
product.attribute(14,) product.attribute.value(355,)
20µl, box of 960 Tips
product.attribute(14,) product.attribute.value(356,)
50µl, box of 960 Tips
product.attribute(14,) product.attribute.value(357,)
100µl, box of 960 Tips
product.attribute(14,) product.attribute.value(358,)
200µl, box of 960 Tips
product.attribute(14,) product.attribute.value(359,)
1000µl, box of 768 Tips
product.attribute(14,) product.attribute.value(386,)
For Gram Negative Isolates (GN1)
product.attribute(14,) product.attribute.value(387,)
For Gram Positive Isolates (GP1)
product.attribute(14,) product.attribute.value(388,)
For Urinary Tract Isolates (UTI)
product.attribute(14,) product.attribute.value(389,)
IonPac AG22 Guard Column, 4x50mm
product.attribute(14,) product.attribute.value(390,)
IonPac AS22 Analytical Column, 4x250mm
product.attribute(14,) product.attribute.value(391,)
3510 pH and Temperature
product.attribute(14,) product.attribute.value(392,)
3540 Combined Conductivity/pH/Temperature
product.attribute(14,) product.attribute.value(396,) product.attribute(14,) product.attribute.value(397,) product.attribute(14,) product.attribute.value(398,)
Sodium Na 1000ppm, 500mL
product.attribute(14,) product.attribute.value(399,)
Potassium K 1000ppm, 500mL
product.attribute(14,) product.attribute.value(400,)
Calcium Ca 1000ppm, 500mL
product.attribute(14,) product.attribute.value(401,)
Lithium Li 1000ppm, 500mL
product.attribute(14,) product.attribute.value(402,)
Barium Ba 1000ppm, 500mL
product.attribute(14,) product.attribute.value(407,)
P system starter setup
product.attribute(14,) product.attribute.value(408,)
P TOC system starter setup
product.attribute(14,) product.attribute.value(428,)
10µL
product.attribute(14,) product.attribute.value(429,)
1µL
product.attribute(14,) product.attribute.value(439,) product.attribute(14,) product.attribute.value(440,)
Green, 10mL
product.attribute(14,) product.attribute.value(441,)
Blue, 2mL
product.attribute(14,) product.attribute.value(442,)
Red, 25mL
product.attribute(14,) product.attribute.value(540,) product.attribute(14,) product.attribute.value(1608,)
for Glass Beakers, Autoclavable
product.attribute(14,) product.attribute.value(1609,)
for Glass Beakers
product.attribute(14,) product.attribute.value(1610,)
for Conical Vessels
product.attribute(14,) product.attribute.value(1611,)
for flasks, 510mm
product.attribute(14,) product.attribute.value(1624,)
Fixed Angle, 5 to 60 rpm
product.attribute(14,) product.attribute.value(1625,)
Digital, Multi-function, 1 to 100 rpm
product.attribute(14,) product.attribute.value(1649,)
With Screw cap
product.attribute(14,) product.attribute.value(1650,)
Without cap
product.attribute(14,) product.attribute.value(1656,) product.attribute(14,) product.attribute.value(1657,) product.attribute(14,) product.attribute.value(1658,) product.attribute(14,) product.attribute.value(1659,) product.attribute(14,) product.attribute.value(1660,) product.attribute(14,) product.attribute.value(1661,) product.attribute(14,) product.attribute.value(1662,) product.attribute(14,) product.attribute.value(1663,) product.attribute(14,) product.attribute.value(1664,) product.attribute(14,) product.attribute.value(1765,)
ABI style, 0.1mL, Clear
product.attribute(14,) product.attribute.value(1766,)
ABI style, 0.2mL, Clear
product.attribute(14,) product.attribute.value(1767,)
ABI FAST® style, 0.1mL, Clear
product.attribute(14,) product.attribute.value(1768,)
LightCycler style, 0.1mL, Clear
product.attribute(14,) product.attribute.value(1769,)
LightCycler style, 0.1mL, White
product.attribute(14,) product.attribute.value(1783,)
CoolCell®, fully covered tops, For 12 standard 1.0 mL to 2.0 mL cryogenic vials
product.attribute(14,) product.attribute.value(1814,)
Speed of Evacuation: 12 L/Min with 1 pump head, Ultimate pressure: 0.075 Mpa
product.attribute(14,) product.attribute.value(1815,)
Speed of Evacuation 30 L/Min with 2 pump head, Ultimate pressure: 0.095 Mpa,
product.attribute(14,) product.attribute.value(1816,)
Speed of Evacuation: 20 L/Min with 1 pump head, Ultimate pressure: 0.08 Mpa,
product.attribute(14,) product.attribute.value(1817,)
Speed of Evacuation: 60 L/Min with 1 pump head, Ultimate pressure: 0.08 Mpa,
product.attribute(14,) product.attribute.value(1818,)
Without interrupter
product.attribute(14,) product.attribute.value(1819,)
with interrupter, thrust: <14N
product.attribute(14,) product.attribute.value(1840,)
Primary Standards for AQ4500, SDVB for 0, 1.0, 10, 100, 1000NTU
product.attribute(14,) product.attribute.value(1841,)
Formazin turbidity standard, 4000NTU, 475mL
product.attribute(14,) product.attribute.value(1842,)
Silicon Oil and Cloth Kit
product.attribute(14,) product.attribute.value(1843,)
Replacement Turbidity Vials, 12/pk
product.attribute(14,) product.attribute.value(1961,)
15 x 15 cm, Ceramic Platform
product.attribute(14,) product.attribute.value(1962,)
6" x 6", Stainless Steel platform
product.attribute(14,) product.attribute.value(1965,)
Ear Protection must be worn area; 300x100mm
product.attribute(14,) product.attribute.value(1972,)
Dangerous Chemicals, 300x200mm
product.attribute(14,) product.attribute.value(1973,)
Harmful Substance, 200x300mm
product.attribute(14,) product.attribute.value(1974,)
Pesticide, 200x300mm
product.attribute(14,) product.attribute.value(1975,)
Flamable Liquid, 200x300mm
product.attribute(14,) product.attribute.value(1976,)
Dangerous when wet, 200x300mm
product.attribute(14,) product.attribute.value(1977,)
Oxidizing agent, 200x300mm
product.attribute(14,) product.attribute.value(1978,)
Corosive, 200x300mm
product.attribute(14,) product.attribute.value(2107,)
AB-1 Balanced Ciders (Saccharomyces Bayanus)
product.attribute(14,) product.attribute.value(2108,)
AS-2 Sweet Ciders (Saccharomyces Cerevisiae)
product.attribute(14,) product.attribute.value(2109,)
AC-4 Crisp Ciders (Saccharomyces Bayanus)
product.attribute(14,) product.attribute.value(2110,)
TF-6 Fruity Ciders (Saccharomyces Cerevisiae)
product.attribute(14,) product.attribute.value(2112,)
Pipette Carousel 2 with holders for 6 Eppendorf Research®, Eppendorf Research® plus, Eppendorf Reference®, Eppendorf Reference® 2 or Biomaster® Pipettes
product.attribute(14,) product.attribute.value(2113,)
Charger Stand 2 for one Eppendorf Xplorer®/Xplorer® plus
product.attribute(14,) product.attribute.value(2114,)
Charger Stand 2 for one Multipette® E3/E3x or Multipette® stream/Xstream
product.attribute(14,) product.attribute.value(2115,)
Pipette Stand 2 for one Multipette® M4 without charging functionality
product.attribute(14,) product.attribute.value(2116,)
Charger Carousel 2 with charger shells for 6 Eppendorf Xplorer®/Xplorer® plus
product.attribute(14,) product.attribute.value(2144,)
4 L/h, single distilled model
product.attribute(14,) product.attribute.value(2145,)
4 L/h, Double distilled model
product.attribute(14,) product.attribute.value(2146,)
8 L/h, single distilled model
product.attribute(14,) product.attribute.value(2147,) product.attribute(14,) product.attribute.value(2230,)
Thermoblock for 24×0.5 mL reaction vessels
product.attribute(14,) product.attribute.value(2231,)
Thermoblock for 24×1.5 mL reaction vessels
product.attribute(14,) product.attribute.value(2232,)
Thermoblock for 24×2.0 mL reaction vessels
product.attribute(14,) product.attribute.value(2233,)
Thermoblock for 8×5.0 mL Eppendorf Tubes
product.attribute(14,) product.attribute.value(2234,)
Thermoblock for 8×15 mL conical tubes
product.attribute(14,) product.attribute.value(2235,)
Thermoblock for 4×50 mL conical tubes
product.attribute(14,) product.attribute.value(2236,)
Thermoblock for 24×11-11.9 mm Ø reaction vessels, height 30 mm -76 mm
product.attribute(14,) product.attribute.value(2237,)
Thermoblock for microplates and deepwell plates, includes lid
product.attribute(14,) product.attribute.value(2238,)
Thermoblock for Eppendorf 96/500 μl deepwell plates, includes lid
product.attribute(14,) product.attribute.value(2239,)
Thermoblock for Eppendorf 96/1000 μl deepwell plates, includes lid
product.attribute(14,) product.attribute.value(2240,)
Thermoblock for 96-well PCR plates, includes lid
product.attribute(14,) product.attribute.value(2241,)
Thermoblock for 384-well PCR plates, includes lid
product.attribute(14,) product.attribute.value(2242,)
Thermoblock for 24 cryo tubes, 1.5 - 2 mL, max. external diameter 12.5 mm, all base designs
product.attribute(14,) product.attribute.value(2438,) product.attribute(14,) product.attribute.value(2457,)
pH: 6.5, 100mL
product.attribute(14,) product.attribute.value(2458,)
pH: 6.5, 250mL
product.attribute(14,) product.attribute.value(2459,)
pH: 7.5, 100mL
product.attribute(14,) product.attribute.value(2460,)
pH: 7.5, 250mL
product.attribute(14,) product.attribute.value(2461,)
pH: 7.0, 100mL
product.attribute(14,) product.attribute.value(2462,)
pH: 7.0, 250mL
product.attribute(14,) product.attribute.value(2469,)
13 x 75 mm, 2.0 mL, Sodium Fluoride 3 mg, Na2EDTA 6 mg
product.attribute(14,) product.attribute.value(2470,)
13 x 75 mm, 2.0 mL, Sodium Fluoride 5 mg, Potassium Oxalate 4 mg
product.attribute(14,) product.attribute.value(2471,) product.attribute(14,) product.attribute.value(2472,)
13 x 75 mm, 4.0 mL, Hemogard™ Closure, Sodium Fluoride 10 mg, Potassium Oxalate 8 mg
product.attribute(14,) product.attribute.value(2473,)
13 x 100 mm, 6.0 mL, Hemogard™ Closure, Sodium Fluoride 15 mg, Potassium Oxalate 12 mg
product.attribute(14,) product.attribute.value(2657,)
multiSUB mini with 7 x 10cm Gel trays
product.attribute(14,) product.attribute.value(2658,)
multiSUB mini with 7 x 7cm Gel trays
product.attribute(14,) product.attribute.value(2659,)
multiSUB mini with 7 x 7cm & 7 x 10cm Gel trays
product.attribute(14,) product.attribute.value(2771,)
With standard measurement tip
product.attribute(14,) product.attribute.value(2772,)
With frozen food measurement tip
product.attribute(14,) product.attribute.value(2857,) product.attribute(14,) product.attribute.value(2858,) product.attribute(14,) product.attribute.value(2859,) product.attribute(14,) product.attribute.value(2860,) product.attribute(14,) product.attribute.value(3188,)
22 mm x 0.22 mm Siliconized circle cover slides, 120/pk
product.attribute(14,) product.attribute.value(3189,)
22 mm x 0.22 mm Siliconized circle cover slides, 1200/pk
product.attribute(14,) product.attribute.value(3190,)
22 mm x 0.96 mm Thick Siliconized circle cover slides, 75/pk
product.attribute(14,) product.attribute.value(3191,)
22 mm x 0.96 mm Thick Siliconized circle cover slides, 750/pk
product.attribute(14,) product.attribute.value(3192,)
22 mm x 0.22 mm Siliconized square cover slides, 100/pk
product.attribute(14,) product.attribute.value(3193,)
22 mm x 0.22 mm Siliconized square cover slides, 1000/pk
product.attribute(14,) product.attribute.value(3194,)
22mmx0.96mm Thick Siliconized square cover slides, 75/pk
product.attribute(14,) product.attribute.value(3195,)
22mmx0.96mm Thick Siliconized square cover slides, 750/pk
product.attribute(14,) product.attribute.value(3205,)
SYTO 9 Green Fluorescent Nucleic Acid Stain
product.attribute(14,) product.attribute.value(3206,)
SYTO 9 Green Fluorescent Nucleic Acid Stain, 100 µL
product.attribute(14,) product.attribute.value(3594,) product.attribute(14,) product.attribute.value(3595,) product.attribute(14,) product.attribute.value(3596,)
Crypto Stain Control, 10 Slides
product.attribute(14,) product.attribute.value(3597,)
Acid Fast Stain Control, 50 Slides
product.attribute(14,) product.attribute.value(3598,)
Gram Stain Control, 50 Slides
product.attribute(14,) product.attribute.value(3601,)
10 µL Heavy Gauge Wire Loops
product.attribute(14,) product.attribute.value(3602,)
10 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3603,)
2.5 µL Heavy Gauge Wire Loops
product.attribute(14,) product.attribute.value(3604,)
1 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3605,)
2.5 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3606,)
2 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3607,)
3.3 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3608,)
5 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3609,)
5 µL Heavy Gauge Wire Loops
product.attribute(14,) product.attribute.value(3824,)
Tube Holder 0.5 mL, for 24 × 0.5 mL reaction vessels
product.attribute(14,) product.attribute.value(3825,)
Tube Holder 1.5/2.0 mL for 24 × 1.5 mL or 2.0 mL reaction vessels
product.attribute(14,) product.attribute.value(3826,)
Tube Holder 5/15 mL for 8 x 5/15 mL conical tubes
product.attribute(14,) product.attribute.value(3827,)
Tube Holder 25/50 mL for 4 x 25/50 mL conical tubes
product.attribute(14,) product.attribute.value(3828,)
Tube Holder PCR 96 for 96 × 0.2 mL PCR tubes, PCR strips or 1 × 96-well PCR plate, semi-skirted or unskirted
product.attribute(14,) product.attribute.value(3904,)
High Protein
product.attribute(14,) product.attribute.value(3905,)
Low Protein
product.attribute(14,) product.attribute.value(3937,)
pkg of 25 plates, L × W 20 cm × 20 cm, glass support
product.attribute(14,) product.attribute.value(3938,)
pkg of 100 plates, L × W 2.5 cm × 7.5 cm, glass support
product.attribute(14,) product.attribute.value(3939,)
pkg of 25 plates, L × W 5 cm × 10 cm, glass support
product.attribute(14,) product.attribute.value(3940,)
pkg of 50 plates, L × W 20 cm × 10 cm, glass support
product.attribute(14,) product.attribute.value(3941,)
pkg of 200 plates, L × W 5 cm × 10 cm, glass support
product.attribute(14,) product.attribute.value(3942,)
pkg of 500 plates, L × W 2.5 cm × 7.5 cm, glass support
product.attribute(14,) product.attribute.value(3943,)
pkg of 25 plates L × W 5 cm × 20 cm, glass support
product.attribute(14,) product.attribute.value(3944,)
pkg of 100 plates L × W 5 cm × 20 cm, glass support
product.attribute(14,) product.attribute.value(3947,)
pkg of 1 roll, roll L × W 500 cm × 20 cm, aluminum support
product.attribute(14,) product.attribute.value(4042,) product.attribute(14,) product.attribute.value(4043,)
X-VIVO™ 15 with L-glutamine, gentamicin, recombinant transferrin and phenol red, 1 L
product.attribute(14,) product.attribute.value(4044,)
X-VIVO™ 10, with L-glutamine, gentamicin, and phenol red, 1 L
product.attribute(14,) product.attribute.value(4109,)
50 x 1.5/2.0 mL rotator drum
product.attribute(14,) product.attribute.value(4110,)
30 x 15 mL rotator drum
product.attribute(14,) product.attribute.value(4111,)
15 x 50 mL rotator drum
product.attribute(14,) product.attribute.value(4112,)
10 x 10/15 mL and 20 x 5/7 mL rotator drum
product.attribute(14,) product.attribute.value(4113,)
64 x diameter 14 mm tube rotator drum
product.attribute(14,) product.attribute.value(4114,)
64 x diameter 18.5 mm tube rotator drum
product.attribute(14,) product.attribute.value(4115,)
142 x diameter 17 mm tube rotator drum
product.attribute(14,) product.attribute.value(4116,)
76 x diameter 26 mm tube rotator drum
product.attribute(14,) product.attribute.value(4117,)
60 x 30 diameter mm tube rotator drum
product.attribute(14,) product.attribute.value(4238,)
TO-PRO™-3 Iodide (642/661), 1 mM Solution in DMSO
product.attribute(14,) product.attribute.value(4239,)
PO-PRO™-1 Iodide (435/455), 1 mM Solution in DMSO
product.attribute(14,) product.attribute.value(4240,)
TO-PRO™-1 Iodide (515/531), 1 mM Solution in DMSO
product.attribute(14,) product.attribute.value(4241,)
YO-PRO™-1 Iodide (491/509)
product.attribute(14,) product.attribute.value(4242,)
YO-PRO™-3 Iodide (612/631), 1 mM Solution in DMSO
product.attribute(14,) product.attribute.value(4335,)
SETA MTVM Gas oil
product.attribute(14,) product.attribute.value(4336,)
SETA MTVM Lubricating oil
product.attribute(14,) product.attribute.value(4337,)
SETA MTVM Kerosine (jet turbine fuel)
product.attribute(14,) product.attribute.value(4338,)
SETA MTVM Fuel oil
product.attribute(14,) product.attribute.value(4339,)
SETA MTVM Motor gasoline
product.attribute(14,) product.attribute.value(4340,)
Speed of Evacuation: 30 L/Min with 1 pump head, Ultimate pressure: 0.08 Mpa
product.attribute(14,) product.attribute.value(4535,)
Disinfectant Wipes (6/pk)
product.attribute(14,) product.attribute.value(4536,)
750ml Spray Bottle, 6/pk
product.attribute(14,) product.attribute.value(4537,)
1 Liter with fragrance
product.attribute(14,) product.attribute.value(4538,)
1 Liter without fragrance
product.attribute(14,) product.attribute.value(4539,)
5 Litres
product.attribute(14,) product.attribute.value(4736,)
RS232 cable for method uploads and data downloads in AQ4000/AQ4500
product.attribute(14,) product.attribute.value(4773,)
pH 10.0, Yellow, 500mL
product.attribute(14,) product.attribute.value(4774,)
pH 7.0, Green, 500mL
product.attribute(14,) product.attribute.value(4810,)
Half-Skirted, Clear, 0.2mL, 25/pk
product.attribute(14,) product.attribute.value(4811,)
Non-Skirted, Clear, 0.2mL, 10/pk
product.attribute(14,) product.attribute.value(4812,)
Non-Skirted, Clear, 0.1mL, 10/pk
product.attribute(14,) product.attribute.value(4813,)
Non-Skirted, White, 0.1mL, 10/pk
product.attribute(14,) product.attribute.value(4814,)
Non-Skirted, White, 0.2mL, 10/pk
product.attribute(14,) product.attribute.value(4815,) product.attribute(14,) product.attribute.value(4816,)
Full-Skirted, White base with clear wells, 0.1mL, 10/pk
product.attribute(14,) product.attribute.value(4817,)
Full-Skirted, White base with white wells, 0.1mL, 10/pk
product.attribute(14,) product.attribute.value(4823,)
0.1 mL, Flat-top caps, White tubes with clear caps
product.attribute(14,) product.attribute.value(4824,)
0.2 mL, Flat-top caps, Clear
product.attribute(14,) product.attribute.value(4825,)
0.1 mL, Flat-top caps, Clear tubes with clear caps
product.attribute(14,) product.attribute.value(4826,)
0.2 mL, Dome-Shaped caps, Clear tubes with clear caps
product.attribute(14,) product.attribute.value(4854,)
2.2 mL Well volume, U-Bottom, Non-Sterile, No cap, 24/bag
product.attribute(14,) product.attribute.value(4855,)
2.2 mL Well volume, U-Bottom, Sterile, No cap, 24/bag
product.attribute(14,) product.attribute.value(4856,)
2.2 mL Well volume, U-Bottom, Non-Sterile, With cap, 24/bag
product.attribute(14,) product.attribute.value(4857,)
2.2 mL Well volume, V-Bottom, Non-Sterile, No cap, 10/bag
product.attribute(14,) product.attribute.value(4858,)
2.2 mL Well volume, V-Bottom, Sterile, No cap, 10/bag
product.attribute(14,) product.attribute.value(4859,)
1.6 mL Well volume, U-Bottom, Non-Sterile, No cap, 24/bag
product.attribute(14,) product.attribute.value(4860,)
1.6 mL Well volume, U-Bottom, Sterile, No cap, 10/bag
product.attribute(14,) product.attribute.value(4861,)
1.6 mL Well volume, U-Bottom, Non-Sterile, With cap, 24/bag
product.attribute(14,) product.attribute.value(4862,)
1.0 mL Well volume, U-Bottom, Non-Sterile, No cap, 5/bag
product.attribute(14,) product.attribute.value(4863,)
1.0 mL Well volume, U-Bottom, Sterile, No cap, 24/bag
product.attribute(14,) product.attribute.value(4864,)
1.0 mL Well volume, U-Bottom, Non-Sterile, With cap, 24/bag
product.attribute(14,) product.attribute.value(4865,)
0.5 mL Well volume, V-Bottom, Sterile, No cap, 10/bag
product.attribute(14,) product.attribute.value(4866,)
0.5 mL Well volume, V-Bottom, Non-Sterile, No cap, 10/bag
product.attribute(14,) product.attribute.value(4991,)
Aluminium head for standard Ø 90 mm Petri dishes (without adapter)
product.attribute(14,) product.attribute.value(4992,)
Aluminium head and adapter for standard Ø 90 mm Petri dishes
product.attribute(14,) product.attribute.value(4993,)
Stainless steel head for standard Ø 90 mm Petri dishes (without adapter)
product.attribute(14,) product.attribute.value(4994,)
Aluminum aspirating head for Ø 55 mm contact plates
product.attribute(14,) product.attribute.value(4995,)
Stainless steel aspirating head for Ø 55 mm contact plates
product.attribute(14,) product.attribute.value(4996,)
Sterile heads for Ø 90 mm Petri dishes, 40/pk
product.attribute(14,) product.attribute.value(4997,)
Sterile heads for Ø 55 mm contact plates, 40/pk
product.attribute(14,) product.attribute.value(5006,)
75ft cable length, Standard Weight, Standard Markers
product.attribute(14,) product.attribute.value(5007,)
75ft cable length, Extra Weight, Standard Markers
product.attribute(14,) product.attribute.value(5008,)
75ft cable length, Asphalt Weight, Standard Markers
product.attribute(14,) product.attribute.value(5009,)
25 Meter cable length, Extra Weight, Metric Markers
product.attribute(14,) product.attribute.value(5010,)
25 Meter cable length, Standard Weight, Metric Markers
Wavelenght
product.attribute(82,) product.attribute.value(1453,)
254nm
product.attribute(82,) product.attribute.value(1454,)
365nm
product.attribute(82,) product.attribute.value(1530,)
302 nm
product.attribute(82,) product.attribute.value(4426,)
492 nm for General Terbium measurement
product.attribute(82,) product.attribute.value(4427,)
520 nm for LanthaScreen measurement of Tb acceptor; HTRF donor measurement of TbGreen
product.attribute(82,) product.attribute.value(4428,)
620 nm for General Europium measurement; LanthaScreen measurement of Eu donor; HTRF acceptor measurement of TbGreen; HTRF donor measurement of EuRed and TbRed
product.attribute(82,) product.attribute.value(4429,)
665 nm for LanthaScreen measurement of Eu acceptor; HTRF acceptor measurement of EuRed and TbRed
20
per Page
20
40
60
View All Products
Events
Antibiotics
60340000263066034000026306
elemen
Surface Protectors
life
Sale
VWR Ammonium chloride ≥99%, GPR RECTAPUR®
VWR Ammonium chloride ≥99%, GPR RECTAPUR®
VWR Ammonium chloride ≥99%, GPR RECTAPUR®
(0)
Sign In to View Price
Sale
Camera: 5 MP, 12/16 bit CCD
Dynamic range: 3.6/4.8 (extended)
Filters: UV032
Image area: 200×240 mm
Lens: 8 - 48 mm f/1.2
Display: 7" (17.8 cm) touchscreen
Software: GeneTools
W×D×H: 310×450×750 mm
Weight: 20 kg
VWR®SMART5, Gel documentation system
VWR®SMART5, Gel documentation system
VWR®SMART5, Gel documentation system
(0)
Sign In to View Price
Sale
Safety cut-off (when in darkroom)
VWR® UV transilluminator for imager systems, 200×200 mm
VWR® UV transilluminator for imager systems, 200×200 mm
VWR® UV transilluminator for imager systems, 200×200 mm
(0)
Sign In to View Price
Sale
200×240 mm, 302 nm, 230 V, 50 Hz with runners
VWR® UV transilluminator for VWR® SMART5 imager system
VWR® UV transilluminator for VWR® SMART5 imager system
VWR® UV transilluminator for VWR® SMART5 imager system
(0)
Sign In to View Price
Sale
VWR® Light Conversion Screen for UV Transilluminators and Gel Documentation systems
VWR® Light Conversion Screen for UV Transilluminators and Gel Documentation systems
VWR® Light Conversion Screen for UV Transilluminators and Gel Documentation systems
(0)
Sign In to View Price
Sale
Camera: 5.4 MP image resolution
Lens: f1.8
Light Sources: Epi White, Dual wavelength transillumination at 302 nm
Field of View: 15 cm x 20 cm
Cabinet: • Door sensor to prevent accidental exposure to UV; automatically shuts off the UV light when the door is open; • Safety override, enabling band cutting on the UV transilluminator with automatic turn off after 5 minutes
Emission Filter: 590 nm
3-position Filter Slider: No
Product Footprint: 12 (30.48 cm x 38.1 cm)
Axygen® Gel documentation system without PC
Axygen® Gel documentation system without PC
Axygen® Gel documentation system without PC
(0)
Sign In to View Price
Sale
Camera: 5.4 MP image resolution
Lens: f1.8
Light Sources: Epi White, Dual wavelength transillumination at 302 nm
Field of View: 15 cm x 20 cm
Cabinet: • Door sensor to prevent accidental exposure to UV; automatically shuts off the UV light when the door is open; • Safety override, enabling band cutting on the UV transilluminator with automatic turn off after 5 minutes
Emission Filter: 590 nm
3-position Filter Slider: Yes
Product Footprint: 12 (30.48 cm x 38.1 cm)
Axygen® Gel documentation system with Windows 8 tablet computer
Axygen® Gel documentation system with Windows 8 tablet computer
Axygen® Gel documentation system with Windows 8 tablet computer
(0)
Sign In to View Price
Sale
For 96 (8×12) microtubes with 0.5 ml capacity or 96 microtubes with 1.5/2 ml capacity
VWR® Racks for Microtubes, 96 places with lid
VWR® Racks for Microtubes, 96 places with lid
VWR® Racks for Microtubes, 96 places with lid
(0)
Sign In to View Price
Sale
Specifications: SpO2 and pulse rate measurement
EDAN Handheld Pulse Oximeter
EDAN Handheld Pulse Oximeter
EDAN Handheld Pulse Oximeter
(0)
Sign In to View Price
Sale
High-sensitivity interchangeable probe
Supports 2MHZ,3MHZ,4MHZ, 5MHZ, 8MHZ waterproof probes
Real-time automatic and manual FHR
Long-time continuous use (about 8h)
EDAN Sonotrax Basic A Fetal Doppler
EDAN Sonotrax Basic A Fetal Doppler
EDAN Sonotrax Basic A Fetal Doppler
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: TGCCGACTACAAGCGAATTACTG
Reverse Sequence: CTGCTTGTCCAGATGACTTCGG
PD-L1 (CD274) Human qPCR Primer Pair (NM_014143), for 200 reactions
PD-L1 (CD274) Human qPCR Primer Pair (NM_014143), for 200 reactions
PD-L1 (CD274) Human qPCR Primer Pair (NM_014143), for 200 reactions
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: GCAGTGTACTTCACAGAGCTGTC
Reverse Sequence: AAGCCAAAGGCTCCAGTCACCA
Lymphocyte Activation Gene 3 (LAG3) Human qPCR Primer Pair (NM_002286)
Lymphocyte Activation Gene 3 (LAG3) Human qPCR Primer Pair (NM_002286)
Lymphocyte Activation Gene 3 (LAG3) Human qPCR Primer Pair (NM_002286)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: GACTCTAGCAGACAGTGGGATC
Reverse Sequence: GGTGGTAAGCATCCTTGGAAAGG
TIM 3 (HAVCR2) Human qPCR Primer Pair (NM_032782)
TIM 3 (HAVCR2) Human qPCR Primer Pair (NM_032782)
TIM 3 (HAVCR2) Human qPCR Primer Pair (NM_032782)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: TCTACTGCCTGGAGGTCACCAG
Reverse Sequence: GACCAAGCAAGACAGAGCCACT
CD244 Human qPCR Primer Pair (NM_016382)
CD244 Human qPCR Primer Pair (NM_016382)
CD244 Human qPCR Primer Pair (NM_016382)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: ACGGGACTCTACATCTGCAAGG
Reverse Sequence: GGAGGAAGTCAGAATCTGGGCA
CTLA4 Human qPCR Primer Pair (NM_005214)
CTLA4 Human qPCR Primer Pair (NM_005214)
CTLA4 Human qPCR Primer Pair (NM_005214)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: GAAAGAGTGGCAACCTGCCTTC
Reverse Sequence: GCACCAAGTTTTACTACATCTGCC
Ki67 (MKI67) Human qPCR Primer Pair (NM_002417)
Ki67 (MKI67) Human qPCR Primer Pair (NM_002417)
Ki67 (MKI67) Human qPCR Primer Pair (NM_002417)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: GCTGGACTTCAGCCCAAAATGC
Reverse Sequence: AGTCCAACCCAGTGTTCCTCTC
CD69 Human qPCR Primer Pair (NM_001781)
CD69 Human qPCR Primer Pair (NM_001781)
CD69 Human qPCR Primer Pair (NM_001781)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: CGACAGTACCATTGAGTTGTGCG
Reverse Sequence: TTCGTCCATAGGAGACAATGCCC
Granzyme B (GZMB) Human qPCR Primer Pair (NM_004131)
Granzyme B (GZMB) Human qPCR Primer Pair (NM_004131)
Granzyme B (GZMB) Human qPCR Primer Pair (NM_004131)
(0)
Sign In to View Price
Sale
Forward Sequence: ACCACAACCACACTCTGGAGGA
Reverse Sequence: TCGGTTTCTGGTCTGGATGCCT
GATA3 Human qPCR Primer Pair (NM_001002295)
GATA3 Human qPCR Primer Pair (NM_001002295)
GATA3 Human qPCR Primer Pair (NM_001002295)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: CCTCCTGCTTTTCATTGGGCTAG
Reverse Sequence: TGAGGACACTGGCAGGTCTTCT
CD4 Human qPCR Primer Pair (NM_000616)
CD4 Human qPCR Primer Pair (NM_000616)
CD4 Human qPCR Primer Pair (NM_000616)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: ACTTGTGGGGTCCTTCTCCTGT
Reverse Sequence: TGTCTCCCGATTTGACCACAGG
CD8A Human qPCR Primer Pair (NM_001768)
CD8A Human qPCR Primer Pair (NM_001768)
CD8A Human qPCR Primer Pair (NM_001768)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: AGAACTCAAACCTCTGGAGGAAG
Reverse Sequence: GCTGTCTCATCAGCATATTCACAC
IL2 Human qPCR Primer Pair (NM_000586)
IL2 Human qPCR Primer Pair (NM_000586)
IL2 Human qPCR Primer Pair (NM_000586)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: GAGTGTGGAGACCATCAAGGAAG
Reverse Sequence: TGCTTTGCGTTGGACATTCAAGTC
Interferon gamma (IFNG) Human qPCR Primer Pair (NM_000619)
Interferon gamma (IFNG) Human qPCR Primer Pair (NM_000619)
Interferon gamma (IFNG) Human qPCR Primer Pair (NM_000619)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: CTCTTCTGCCTGCTGCACTTTG
Reverse Sequence: ATGGGCTACAGGCTTGTCACTC
TNF alpha (TNF) Human qPCR Primer Pair (NM_000594)
TNF alpha (TNF) Human qPCR Primer Pair (NM_000594)
TNF alpha (TNF) Human qPCR Primer Pair (NM_000594)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: ATCGCAGCACTCACTGACCTGT
Reverse Sequence: TCAGGCACTTTACCTCCACGAG
IL7R alpha (IL7R) Human qPCR Primer Pair (NM_002185)
IL7R alpha (IL7R) Human qPCR Primer Pair (NM_002185)
IL7R alpha (IL7R) Human qPCR Primer Pair (NM_002185)
(0)
Sign In to View Price
Showing 25 Of 5627
76
77
78
79
80
我们使用cookies为您提供在这网站上更好的用户体验。
Cookie 政策
只有必需品
同意