LabMart Knowledge Center
Schedule a meeting
+233302452966
My Account
My Orders
My Wishlist (
0
)
LabMart Knowledge Center
Schedule a meeting
+233302452966
My Account
My Orders
My Wishlist (
0
)
All Products
View All Products
View All Products
Agricultural Research products
Autoclaving & Sterilization
Centrifuges and Microcentrifuges
Chemicals
Chromatography
Basic Science Laboratory Products
Cold Storage Products
Desiccation and Evaporation
Filters and Filtration
Laboratory Ventilation
Laboratory Equipment and Instruments
Personal Protective Equipment
Medical Supplies
Industrial Instruments
Life Sciences
Testing and Filtration
Glassware & Plasticware
Laboratory Quality Control Solutions
Entomology Supplies
Sample Preparation
Agricultural Research products
Agricultural Research products
Autoclaving & Sterilization
Autoclaving & Sterilization
Autoclave Bags
Glassware Washers and Dryers
Sterilization Verification Indicators
Sterilizer and Autoclave Accessories
Books & Reference Materials
Books & Reference Materials
Centrifuges and Microcentrifuges
Centrifuges and Microcentrifuges
Benchtop Centrifuges
Centrifuge Accessories
Centrifuge Tubes and Bottles
Floor Model Centrifuges
Microcentrifuges
Chemicals
Chemicals
Analytical and Chromatography Solvents
Biochemicals and Diagnostics
Biomedical Polymers
Organic compounds
Salts and Inorganics
Chromatography and Mass Spectrometry Reagents
Stains, Dyes and Indicators
Resins and Supports
Life Science Chemicals
Chromatography
Chromatography
Autosamplers and Injectors
Autosampler Vial Crimpers and Decappers
Autosampler Vials, Caps, and Closures
Chromatography Fittings & Tools
Chromatography Columns and Cartridges
Chromatography Instruments
Chromatography Syringes
Ion Chromatography
Solid Phase Extraction (SPE)
Thin Layer Chromatography
Basic Science Laboratory Products
Basic Science Laboratory Products
Biology Classroom
Chemistry Classroom
Physics Classroom
Patient Care Simulators
Cold Storage Products
Cold Storage Products
Cryogenic Storage Solutions
Freezers
Refrigerator and Freezer Accessories
Refrigerators
Desiccation and Evaporation
Desiccation and Evaporation
Desiccants and Drying Agents
Desiccators
Evaporators
Freeze Drying Chambers and Equipment
Glass Drying Tubes
Filters and Filtration
Filters and Filtration
Bottle Tops and Filter Units
Extraction Thimbles
Filter Holders and Hardware
Filtering Funnels
Filter Paper
Glass Fiber Filters and Prefilters
Membranes for Filtration
Syringe and Syringeless Filters
Laboratory Ventilation
Laboratory Ventilation
Biological Safety Cabinets
Laboratory Hoods and Enclosures
Laboratory Equipment and Instruments
Laboratory Equipment and Instruments
Balances, Scales and Weighing
Baths
Burners and Lighters
Furnaces
Heaters and Heating Mantles
Hotplates and Hotplate Stirrers
Incubators, Hot Plates, Baths and Heating
Extraction Systems
Melting Point Apparatus
Mixers, Shakers and Stirrers
Pumps
Recirculating Chillers
Spatulas, Forceps and Utensils
Thermometers, Timers and pH Meters
Moisture meters
Viscometers
Spectrophotometers, Refractometers and Benchtop Instruments
Titrators
Refractometers & Polarimeters
Extraction Systems
Extraction Systems
Personal Protective Equipment
Personal Protective Equipment
Eyewashes and Showers
First Aid Products
Hand Protection
Lab Coats, Aprons and Apparel
Laboratory Wipes, Cleaners, and Disinfectants
Surface Protectors
Industrial Instruments
Industrial Instruments
Industrial Scales and Balances
Life Sciences
Life Sciences
Antibodies
Cell Analysis
Electrophoresis, Western Blotting and ELISA
Enzymes and Inhibitors
Microbiology
Cell & Tissue Culture
Molecular Biology, Reagents and Kits
Liquid Handling
Protein Analysis Reagents
Sealing Films, Foils & Tapes
Life Science Buffers
Microarray Scanners and Accessories
Genetic Analysis
Glassware & Plasticware
Glassware & Plasticware
Transfection & Cloning
Transfection & Cloning
Laboratory Quality Control Solutions
Laboratory Quality Control Solutions
Books & Reference Materials
Buffers and Solutions
Certified Reference Materials
Lyophilized Quality Control Organisms
Molecular Quality Controls and Standards
Entomology Supplies
Entomology Supplies
Sample Preparation
Sample Preparation
Sonicators, Homogenizers and Blenders
Laboratory Mills
Log in
|
Sign Up
0
0
My Account
My Orders
My Wishlist (
0
)
Password Reset
Logout
All Products
Menu
View All Products
Agricultural Research products
Autoclaving & Sterilization
Centrifuges and Microcentrifuges
Chemicals
Chromatography
Basic Science Laboratory Products
Cold Storage Products
Desiccation and Evaporation
Filters and Filtration
Laboratory Ventilation
Laboratory Equipment and Instruments
Personal Protective Equipment
Medical Supplies
Industrial Instruments
Life Sciences
Testing and Filtration
Glassware & Plasticware
Laboratory Quality Control Solutions
Entomology Supplies
Sample Preparation
Agricultural Research products
Autoclaving & Sterilization
Autoclave Bags
Glassware Washers and Dryers
Sterilization Verification Indicators
Sterilizer and Autoclave Accessories
Books & Reference Materials
Centrifuges and Microcentrifuges
Benchtop Centrifuges
Centrifuge Accessories
Centrifuge Tubes and Bottles
Floor Model Centrifuges
Microcentrifuges
Chemicals
Analytical and Chromatography Solvents
Biochemicals and Diagnostics
Biomedical Polymers
Organic compounds
Salts and Inorganics
Chromatography and Mass Spectrometry Reagents
Stains, Dyes and Indicators
Resins and Supports
Life Science Chemicals
Chromatography
Autosamplers and Injectors
Autosampler Vial Crimpers and Decappers
Autosampler Vials, Caps, and Closures
Chromatography Fittings & Tools
Chromatography Columns and Cartridges
Chromatography Instruments
Chromatography Syringes
Ion Chromatography
Solid Phase Extraction (SPE)
Thin Layer Chromatography
Basic Science Laboratory Products
Biology Classroom
Chemistry Classroom
Physics Classroom
Patient Care Simulators
Cold Storage Products
Cryogenic Storage Solutions
Freezers
Refrigerator and Freezer Accessories
Refrigerators
Desiccation and Evaporation
Desiccants and Drying Agents
Desiccators
Evaporators
Freeze Drying Chambers and Equipment
Glass Drying Tubes
Filters and Filtration
Bottle Tops and Filter Units
Extraction Thimbles
Filter Holders and Hardware
Filtering Funnels
Filter Paper
Glass Fiber Filters and Prefilters
Membranes for Filtration
Syringe and Syringeless Filters
Laboratory Ventilation
Biological Safety Cabinets
Laboratory Hoods and Enclosures
Laboratory Equipment and Instruments
Balances, Scales and Weighing
Baths
Burners and Lighters
Furnaces
Heaters and Heating Mantles
Hotplates and Hotplate Stirrers
Incubators, Hot Plates, Baths and Heating
Extraction Systems
Melting Point Apparatus
Mixers, Shakers and Stirrers
Pumps
Recirculating Chillers
Spatulas, Forceps and Utensils
Thermometers, Timers and pH Meters
Moisture meters
Viscometers
Spectrophotometers, Refractometers and Benchtop Instruments
Titrators
Refractometers & Polarimeters
Extraction Systems
Personal Protective Equipment
Eyewashes and Showers
First Aid Products
Hand Protection
Lab Coats, Aprons and Apparel
Laboratory Wipes, Cleaners, and Disinfectants
Surface Protectors
Industrial Instruments
Industrial Scales and Balances
Life Sciences
Antibodies
Cell Analysis
Electrophoresis, Western Blotting and ELISA
Enzymes and Inhibitors
Microbiology
Cell & Tissue Culture
Molecular Biology, Reagents and Kits
Liquid Handling
Protein Analysis Reagents
Sealing Films, Foils & Tapes
Life Science Buffers
Microarray Scanners and Accessories
Genetic Analysis
Glassware & Plasticware
Transfection & Cloning
Laboratory Quality Control Solutions
Books & Reference Materials
Buffers and Solutions
Certified Reference Materials
Lyophilized Quality Control Organisms
Molecular Quality Controls and Standards
Entomology Supplies
Sample Preparation
Sonicators, Homogenizers and Blenders
Laboratory Mills
首页
商店
约会
联系我们
0
0
+1 (650) 555-0111
登录
联系我们
0
0
首页
商店
约会
联系我们
+1 (650) 555-0111
登录
联系我们
7324 RESULTS FOR “”
Filters
In-Stock
In-Stock
Application
Microbiology
molecular biology
Analytical Chemistry
Gel Electrophoresis
Filtration
AAS
Diagnostic Testing
Serology
Grade
Laboratory grade
Microbiology grade
Medical grade
Molecular Biology
Analytical grade
Brand
Sterlitech
CTK Biotech
Apollo Scientific
Thermo Fisher Scientific™
Oxoid
VWR
Filter Pore Size
product.attribute(209,) product.attribute.value(5532,)
12 µm
product.attribute(209,) product.attribute.value(5533,)
20 µm
product.attribute(209,) product.attribute.value(5534,)
30 µm
Pack Size
product.attribute(6,) product.attribute.value(330,) product.attribute(6,) product.attribute.value(3234,)
1 x 1 mL, sufficient for 100 Rxns
product.attribute(6,) product.attribute.value(3235,)
1 x 5 mL, sufficient for 500 Rxns
product.attribute(6,) product.attribute.value(3236,)
2 x 5 mL, sufficient for 1000 Rxns
product.attribute(6,) product.attribute.value(3237,)
5 x 5 mL, sufficient for 2500 Rxns
product.attribute(6,) product.attribute.value(3238,)
10 x 5 mL, sufficient for 5000 Rxns
product.attribute(6,) product.attribute.value(3239,)
1 x 50 mL, sufficient for 5000 Rxns
product.attribute(6,) product.attribute.value(3253,)
1 x 1 mL, sufficient for 40 Rxns
product.attribute(6,) product.attribute.value(3254,)
1 x 5 mL, sufficient for 200 Rxns
product.attribute(6,) product.attribute.value(3255,)
2 x 5 mL, sufficient for 400 Rxns
product.attribute(6,) product.attribute.value(3256,)
5 x 5 mL, sufficient for 1000 Rxns
product.attribute(6,) product.attribute.value(3257,)
10 x 5 mL, sufficient for 2000 Rxns
product.attribute(6,) product.attribute.value(3258,)
1 x 50 mL, sufficient for 2000 Rxns
product.attribute(6,) product.attribute.value(3282,)
10,000 UNITS (5 μg, 50 mL)
product.attribute(6,) product.attribute.value(3283,)
10,000 UNITS (5 μg, 5 mL)
product.attribute(6,) product.attribute.value(3284,)
50,000 UNITS (25 μg, 5 mL)
product.attribute(6,) product.attribute.value(3295,)
1 x 10 mL, sufficient for 400 Rxns
product.attribute(6,) product.attribute.value(3296,)
2 x 10 mL, sufficient for 800 Rxns
product.attribute(6,) product.attribute.value(3297,)
2 x 50 mL, sufficient for 4,000 Rxns
product.attribute(6,) product.attribute.value(3298,)
1 x 1 mL, sufficient for 200 Rxns
product.attribute(6,) product.attribute.value(3299,)
1 x 10 mL, sufficient for 2,000 Rxns
product.attribute(6,) product.attribute.value(3300,)
2 x 10 mL, sufficient for 4,000 Rxns
product.attribute(6,) product.attribute.value(3301,)
1 x 50 mL, sufficient for 10,000 Rxns
product.attribute(6,) product.attribute.value(3302,)
2 x 50 mL, sufficient for 20,000 Rxns
product.attribute(6,) product.attribute.value(859,)
Size: 300 U, Concentration: 10 U/μL
product.attribute(6,) product.attribute.value(4596,)
500 mL, BSA: 2 mg/mL (Sufficient for 250 tube assays or 2500 microplate assays)
product.attribute(6,) product.attribute.value(860,)
Size: 1,000 U, Concentration: 10 U/μL
product.attribute(6,) product.attribute.value(4597,)
1L, BSA: 2 mg/mL (Sufficient for 500 tube assays or 5000 microplate assays)
product.attribute(6,) product.attribute.value(861,)
Size: 1,000 U, Concentration: 20 U/μL
product.attribute(6,) product.attribute.value(4598,)
500 mL, BSA: 0.125, 0.25, 0.5, 0.75, 1, 1.5, and 2 mg/mL (Sufficient for 250 tube assays or 2500 microplate assays)
product.attribute(6,) product.attribute.value(4599,)
1L, BSA: 0.125, 0.25, 0.5, 0.75, 1, 1.5, and 2 mg/mL (Sufficient for 500 tube assays or 5000 microplate assays)
product.attribute(6,) product.attribute.value(72,) product.attribute(6,) product.attribute.value(73,) product.attribute(6,) product.attribute.value(74,) product.attribute(6,) product.attribute.value(75,) product.attribute(6,) product.attribute.value(76,) product.attribute(6,) product.attribute.value(77,) product.attribute(6,) product.attribute.value(83,)
500mL
product.attribute(6,) product.attribute.value(84,)
1L
product.attribute(6,) product.attribute.value(85,)
2.5L
product.attribute(6,) product.attribute.value(86,) product.attribute(6,) product.attribute.value(87,) product.attribute(6,) product.attribute.value(88,)
250g
product.attribute(6,) product.attribute.value(89,)
1kg
product.attribute(6,) product.attribute.value(90,)
100g
product.attribute(6,) product.attribute.value(91,)
500g
product.attribute(6,) product.attribute.value(92,)
5kg
product.attribute(6,) product.attribute.value(93,)
2kg
product.attribute(6,) product.attribute.value(94,)
50 Preps
product.attribute(6,) product.attribute.value(95,)
250 Preps
product.attribute(6,) product.attribute.value(96,) product.attribute(6,) product.attribute.value(97,) product.attribute(6,) product.attribute.value(98,)
50 reactions
product.attribute(6,) product.attribute.value(99,)
250 reactions
product.attribute(6,) product.attribute.value(100,)
Concentration: 8,000 units/ml, Size: 1,600 units
product.attribute(6,) product.attribute.value(101,)
Concentration: 8,000 units/ml, Size: 8,000 units
product.attribute(6,) product.attribute.value(102,)
Concentration: 120,000 units/ml, Size: 8,000 units
product.attribute(6,) product.attribute.value(103,) product.attribute(6,) product.attribute.value(104,) product.attribute(6,) product.attribute.value(105,) product.attribute(6,) product.attribute.value(106,)
20 Plates
product.attribute(6,) product.attribute.value(107,)
50 Plates
product.attribute(6,) product.attribute.value(116,) product.attribute(6,) product.attribute.value(117,) product.attribute(6,) product.attribute.value(118,)
500 Grams
product.attribute(6,) product.attribute.value(119,)
250 Grams
product.attribute(6,) product.attribute.value(120,)
1 x 1,000 ml
product.attribute(6,) product.attribute.value(121,)
4 x 1,000 mL
product.attribute(6,) product.attribute.value(122,)
1 x 500 mL
product.attribute(6,) product.attribute.value(123,)
10 x 50 mL
product.attribute(6,) product.attribute.value(124,)
1 x 100 mL
product.attribute(6,) product.attribute.value(125,)
5 x 100 mL
product.attribute(6,) product.attribute.value(137,)
5 Liters
product.attribute(6,) product.attribute.value(138,)
10 Liters
product.attribute(6,) product.attribute.value(139,)
25 Liters
product.attribute(6,) product.attribute.value(151,) product.attribute(6,) product.attribute.value(152,)
200 Reactions
product.attribute(6,) product.attribute.value(153,)
500 Reactions
product.attribute(6,) product.attribute.value(154,)
4,000 Units
product.attribute(6,) product.attribute.value(155,)
10,000 Units
product.attribute(6,) product.attribute.value(156,) product.attribute(6,) product.attribute.value(157,) product.attribute(6,) product.attribute.value(158,) product.attribute(6,) product.attribute.value(159,)
25 mL
product.attribute(6,) product.attribute.value(160,)
50 mL
product.attribute(6,) product.attribute.value(161,)
100 mL
product.attribute(6,) product.attribute.value(166,)
for 20 Tests
product.attribute(6,) product.attribute.value(167,)
for 4 Tests
product.attribute(6,) product.attribute.value(288,)
100 Grams
product.attribute(6,) product.attribute.value(289,)
50 Grams
product.attribute(6,) product.attribute.value(324,)
500 μL
product.attribute(6,) product.attribute.value(325,)
1 mL
product.attribute(6,) product.attribute.value(326,) product.attribute(6,) product.attribute.value(327,) product.attribute(6,) product.attribute.value(328,) product.attribute(6,) product.attribute.value(331,) product.attribute(6,) product.attribute.value(335,) product.attribute(6,) product.attribute.value(336,)
100μL
product.attribute(6,) product.attribute.value(337,) product.attribute(6,) product.attribute.value(345,) product.attribute(6,) product.attribute.value(346,) product.attribute(6,) product.attribute.value(347,)
1 x 1 Liter
product.attribute(6,) product.attribute.value(348,) product.attribute(6,) product.attribute.value(349,) product.attribute(6,) product.attribute.value(350,) product.attribute(6,) product.attribute.value(351,) product.attribute(6,) product.attribute.value(352,) product.attribute(6,) product.attribute.value(353,) product.attribute(6,) product.attribute.value(360,)
5 Grams
product.attribute(6,) product.attribute.value(361,)
25 Grams
product.attribute(6,) product.attribute.value(362,)
1 Gram
product.attribute(6,) product.attribute.value(363,)
10mg
product.attribute(6,) product.attribute.value(364,)
50mg
product.attribute(6,) product.attribute.value(365,)
100mg
product.attribute(6,) product.attribute.value(366,)
250mg
product.attribute(6,) product.attribute.value(367,)
1g
product.attribute(6,) product.attribute.value(368,)
5 mL
product.attribute(6,) product.attribute.value(369,)
500 mL
product.attribute(6,) product.attribute.value(370,)
300mg
product.attribute(6,) product.attribute.value(371,)
5g
product.attribute(6,) product.attribute.value(372,)
10g
product.attribute(6,) product.attribute.value(373,)
25g
product.attribute(6,) product.attribute.value(374,)
50g
product.attribute(6,) product.attribute.value(393,)
1000 Reactions
product.attribute(6,) product.attribute.value(394,) product.attribute(6,) product.attribute.value(395,) product.attribute(6,) product.attribute.value(478,)
250 mL
product.attribute(6,) product.attribute.value(479,) product.attribute(6,) product.attribute.value(480,) product.attribute(6,) product.attribute.value(481,) product.attribute(6,) product.attribute.value(482,) product.attribute(6,) product.attribute.value(483,)
1 LIter
product.attribute(6,) product.attribute.value(484,)
2.5 Liters
product.attribute(6,) product.attribute.value(493,)
200 mL
product.attribute(6,) product.attribute.value(500,)
10 Grams
product.attribute(6,) product.attribute.value(542,)
2.5 Kg
product.attribute(6,) product.attribute.value(624,)
500mg
product.attribute(6,) product.attribute.value(670,)
12 mL
product.attribute(6,) product.attribute.value(692,)
50 Tablets per bottle
product.attribute(6,) product.attribute.value(693,)
100 Tablets per bottle
product.attribute(6,) product.attribute.value(694,) product.attribute(6,) product.attribute.value(701,)
20 mL
product.attribute(6,) product.attribute.value(708,)
25kg
product.attribute(6,) product.attribute.value(743,)
200 µl
product.attribute(6,) product.attribute.value(758,)
5 X 5 mL
product.attribute(6,) product.attribute.value(759,)
5 X 10 mL
product.attribute(6,) product.attribute.value(762,) product.attribute(6,) product.attribute.value(774,)
1000 UNITS
product.attribute(6,) product.attribute.value(775,)
5000 UNITS
product.attribute(6,) product.attribute.value(776,)
10000 UNITS
product.attribute(6,) product.attribute.value(777,)
50000 UNITS
product.attribute(6,) product.attribute.value(846,)
10 mL
product.attribute(6,) product.attribute.value(847,)
4 Liters
product.attribute(6,) product.attribute.value(862,)
5 x 1 mL
product.attribute(6,) product.attribute.value(895,)
300 reactions
product.attribute(6,) product.attribute.value(896,)
2400 reactions
product.attribute(6,) product.attribute.value(992,)
150 Tests/Kit
product.attribute(6,) product.attribute.value(993,)
450 Tests/Kit
product.attribute(6,) product.attribute.value(994,)
For 50 Tests
product.attribute(6,) product.attribute.value(995,)
For 100 Tests
product.attribute(6,) product.attribute.value(997,)
5mg
product.attribute(6,) product.attribute.value(998,)
25mg
product.attribute(6,) product.attribute.value(1074,)
6x500mL
product.attribute(6,) product.attribute.value(1075,) product.attribute(6,) product.attribute.value(1092,)
500 assays
product.attribute(6,) product.attribute.value(1093,)
100 assays
product.attribute(6,) product.attribute.value(1105,)
15 mL
product.attribute(6,) product.attribute.value(1106,)
60 mL
product.attribute(6,) product.attribute.value(1107,)
475 mL
product.attribute(6,) product.attribute.value(1214,)
30 mL
product.attribute(6,) product.attribute.value(1215,)
4 x 1.25 mL
product.attribute(6,) product.attribute.value(1226,)
pack of 10
product.attribute(6,) product.attribute.value(1227,)
pack of 50
product.attribute(6,) product.attribute.value(1228,)
pack of 100
product.attribute(6,) product.attribute.value(1229,)
pack of 250
product.attribute(6,) product.attribute.value(1279,)
1mg
product.attribute(6,) product.attribute.value(1280,)
10 Million
product.attribute(6,) product.attribute.value(1281,)
20 Million
product.attribute(6,) product.attribute.value(1282,)
50 Million
product.attribute(6,) product.attribute.value(1283,)
50 µg
product.attribute(6,) product.attribute.value(1284,)
500 µg
product.attribute(6,) product.attribute.value(1285,)
25 µg
product.attribute(6,) product.attribute.value(1286,)
100 µg
product.attribute(6,) product.attribute.value(1397,) product.attribute(6,) product.attribute.value(1420,) product.attribute(6,) product.attribute.value(1421,) product.attribute(6,) product.attribute.value(1422,)
50 UNITS
product.attribute(6,) product.attribute.value(1423,)
250 UNITS
product.attribute(6,) product.attribute.value(1424,)
pack of 500
product.attribute(6,) product.attribute.value(1425,)
pack of 1000
product.attribute(6,) product.attribute.value(1435,)
59.2 mL
product.attribute(6,) product.attribute.value(1436,)
118.3 mL
product.attribute(6,) product.attribute.value(1444,)
500 UNITS
product.attribute(6,) product.attribute.value(1445,)
2,500 UNITS
product.attribute(6,) product.attribute.value(1446,)
2,000 UNITS
product.attribute(6,) product.attribute.value(1447,)
25000 UNITS
product.attribute(6,) product.attribute.value(1448,)
200 UNITS
product.attribute(6,) product.attribute.value(1457,)
2.5g
product.attribute(6,) product.attribute.value(1551,) product.attribute(6,) product.attribute.value(1552,) product.attribute(6,) product.attribute.value(1575,)
400 mL
product.attribute(6,) product.attribute.value(1705,) product.attribute(6,) product.attribute.value(1706,) product.attribute(6,) product.attribute.value(1707,)
2L
product.attribute(6,) product.attribute.value(1716,)
1 Pkg
product.attribute(6,) product.attribute.value(1717,)
10 Pkg
product.attribute(6,) product.attribute.value(1718,)
5 x 10 Pkg
product.attribute(6,) product.attribute.value(1719,)
6 x 100 mL
product.attribute(6,) product.attribute.value(1720,) product.attribute(6,) product.attribute.value(1745,)
200 Liters Metal drum
product.attribute(6,) product.attribute.value(1746,)
20 Liters
product.attribute(6,) product.attribute.value(1832,)
1 x 5 mL
product.attribute(6,) product.attribute.value(1833,)
10 x 5 mL
product.attribute(6,) product.attribute.value(1834,) product.attribute(6,) product.attribute.value(1835,) product.attribute(6,) product.attribute.value(1862,)
50 x 1.5 mL
product.attribute(6,) product.attribute.value(1863,)
20 x 5 mL
product.attribute(6,) product.attribute.value(1866,) product.attribute(6,) product.attribute.value(1867,) product.attribute(6,) product.attribute.value(1877,)
1,000 units
product.attribute(6,) product.attribute.value(1878,)
5,000 units
product.attribute(6,) product.attribute.value(1896,)
2.5kg
product.attribute(6,) product.attribute.value(2077,)
4kg
product.attribute(6,) product.attribute.value(2078,)
8kg
product.attribute(6,) product.attribute.value(2079,)
20kg
product.attribute(6,) product.attribute.value(2080,)
9kg
product.attribute(6,) product.attribute.value(2098,)
165 mL
product.attribute(6,) product.attribute.value(2103,)
56.7g
product.attribute(6,) product.attribute.value(2104,)
454g
product.attribute(6,) product.attribute.value(2105,)
28g
product.attribute(6,) product.attribute.value(2106,)
226.8g
product.attribute(6,) product.attribute.value(2111,)
pack of 30
product.attribute(6,) product.attribute.value(2171,)
5/pk
product.attribute(6,) product.attribute.value(2172,)
25/pk
product.attribute(6,) product.attribute.value(2173,)
100/pk
product.attribute(6,) product.attribute.value(2174,)
1/pk
product.attribute(6,) product.attribute.value(2175,)
20 µl
product.attribute(6,) product.attribute.value(2176,)
50 µl
product.attribute(6,) product.attribute.value(2177,)
100 µl
product.attribute(6,) product.attribute.value(2220,) product.attribute(6,) product.attribute.value(2221,) product.attribute(6,) product.attribute.value(2222,) product.attribute(6,) product.attribute.value(2223,) product.attribute(6,) product.attribute.value(2251,) product.attribute(6,) product.attribute.value(2252,) product.attribute(6,) product.attribute.value(2426,)
Bag-in-box (Cubitainer), 10L
product.attribute(6,) product.attribute.value(2427,)
Plastic drum, 10L
product.attribute(6,) product.attribute.value(2428,)
Plastic drum, 20L
product.attribute(6,) product.attribute.value(2476,)
1000 mL
product.attribute(6,) product.attribute.value(2477,) product.attribute(6,) product.attribute.value(2478,) product.attribute(6,) product.attribute.value(2480,)
For 5000 Tests
product.attribute(6,) product.attribute.value(2481,)
For 20000 Tests
product.attribute(6,) product.attribute.value(2482,)
2 TABS
product.attribute(6,) product.attribute.value(2483,)
20 TABS
product.attribute(6,) product.attribute.value(2496,)
800 mL
product.attribute(6,) product.attribute.value(2532,)
2 x 250 mL in spray bottles
product.attribute(6,) product.attribute.value(2533,)
Refill, 2 x 1 Liter
product.attribute(6,) product.attribute.value(2534,)
Refill for Solution I, 1 Liter
product.attribute(6,) product.attribute.value(2535,)
Refill for Solution II, 1 Liter
product.attribute(6,) product.attribute.value(2538,)
2 Liters
product.attribute(6,) product.attribute.value(2539,)
450 mL
product.attribute(6,) product.attribute.value(2549,)
5 x 2 mL
product.attribute(6,) product.attribute.value(2550,)
2 mL
product.attribute(6,) product.attribute.value(2551,)
500 µL
product.attribute(6,) product.attribute.value(2552,)
20 x 50 µL
product.attribute(6,) product.attribute.value(2660,)
3kg
product.attribute(6,) product.attribute.value(2689,) product.attribute(6,) product.attribute.value(2690,) product.attribute(6,) product.attribute.value(2691,) product.attribute(6,) product.attribute.value(2692,)
10 x 1L
product.attribute(6,) product.attribute.value(2693,)
10L
product.attribute(6,) product.attribute.value(2694,)
50L
product.attribute(6,) product.attribute.value(2740,)
400g
product.attribute(6,) product.attribute.value(2741,) product.attribute(6,) product.attribute.value(2783,)
10kg
product.attribute(6,) product.attribute.value(2793,)
20 x 100 mL
product.attribute(6,) product.attribute.value(2794,)
10 x 500 mL
product.attribute(6,) product.attribute.value(2795,)
1500 UNITS
product.attribute(6,) product.attribute.value(2796,)
20 X 250 UNITS
product.attribute(6,) product.attribute.value(2797,) product.attribute(6,) product.attribute.value(2798,) product.attribute(6,) product.attribute.value(2799,) product.attribute(6,) product.attribute.value(2807,)
50/pk
product.attribute(6,) product.attribute.value(2808,)
500/case
product.attribute(6,) product.attribute.value(2809,)
20/pk
product.attribute(6,) product.attribute.value(2810,)
1000/Case
product.attribute(6,) product.attribute.value(2829,)
10/pk
product.attribute(6,) product.attribute.value(2830,)
30/pk
product.attribute(6,) product.attribute.value(2834,)
6 x 500 mL
product.attribute(6,) product.attribute.value(2841,)
10 x 10mL pack, Freeze-Dried
product.attribute(6,) product.attribute.value(2842,)
10 x 100mL pack, Freeze-Dried
product.attribute(6,) product.attribute.value(2850,)
For 100 Isolates X 300 μl
product.attribute(6,) product.attribute.value(2851,)
For 500 Isolates X 300 μl
product.attribute(6,) product.attribute.value(2852,)
For 100 Isolates X 10mL
product.attribute(6,) product.attribute.value(2855,)
Enough to prepare 5L of Liquid medium
product.attribute(6,) product.attribute.value(2856,)
Enough to prepare 25L of Liquid medium
product.attribute(6,) product.attribute.value(2910,)
2 Plates
product.attribute(6,) product.attribute.value(2911,) product.attribute(6,) product.attribute.value(2912,) product.attribute(6,) product.attribute.value(2932,)
2 Gels/Box
product.attribute(6,) product.attribute.value(2933,)
10 Gels/Box
product.attribute(6,) product.attribute.value(2944,)
2 x 250 µL
product.attribute(6,) product.attribute.value(2945,)
10 x 250 µL
product.attribute(6,) product.attribute.value(2946,)
10 x 1 mL
product.attribute(6,) product.attribute.value(2947,)
10 x 10 mL
product.attribute(6,) product.attribute.value(2950,)
for 25 Tests
product.attribute(6,) product.attribute.value(2951,)
10 x 500 UNITS
product.attribute(6,) product.attribute.value(2952,)
5 x 500 UNITS
product.attribute(6,) product.attribute.value(2953,)
20 x 500 UNI
product.attribute(6,) product.attribute.value(2971,)
6 mL
product.attribute(6,) product.attribute.value(2978,)
250/pk
product.attribute(6,) product.attribute.value(2994,)
5L
product.attribute(6,) product.attribute.value(2995,)
25L
product.attribute(6,) product.attribute.value(3015,)
For 10 Preps
product.attribute(6,) product.attribute.value(3016,)
For 50 preps
product.attribute(6,) product.attribute.value(3017,)
For 50 Preps
product.attribute(6,) product.attribute.value(3018,)
12/pk
product.attribute(6,) product.attribute.value(3037,)
5 x 50 µg
product.attribute(6,) product.attribute.value(3038,)
4 x 10,000 units for 200 Rxn
product.attribute(6,) product.attribute.value(3039,)
2,000 units for 10 Rxn
product.attribute(6,) product.attribute.value(3040,)
10,000 units for 50 Rxns
product.attribute(6,) product.attribute.value(3041,)
0.2 mL
product.attribute(6,) product.attribute.value(3053,)
7kg
product.attribute(6,) product.attribute.value(3058,)
50 X 40 mL
product.attribute(6,) product.attribute.value(3059,)
50 X 50 mL
product.attribute(6,) product.attribute.value(3060,)
5 x 50 mL
product.attribute(6,) product.attribute.value(3061,)
5 X 200 mL
product.attribute(6,) product.attribute.value(3062,)
50 X 3 mL
product.attribute(6,) product.attribute.value(3065,)
For 100 Preps
product.attribute(6,) product.attribute.value(3066,)
For 1000 Preps
product.attribute(6,) product.attribute.value(3067,)
For 2500 Preps
product.attribute(6,) product.attribute.value(3068,)
0.4 mL
product.attribute(6,) product.attribute.value(3073,)
For 25 preps
product.attribute(6,) product.attribute.value(3074,)
0.1 mL
product.attribute(6,) product.attribute.value(3075,)
0.75 mL
product.attribute(6,) product.attribute.value(3076,)
1.5 mL
product.attribute(6,) product.attribute.value(3077,)
5 x 1.5 mL
product.attribute(6,) product.attribute.value(3085,)
10 x 100 mL
product.attribute(6,) product.attribute.value(3088,)
10 mM x 1 mL in DMSO
product.attribute(6,) product.attribute.value(3089,)
200mg
product.attribute(6,) product.attribute.value(3090,)
2g
product.attribute(6,) product.attribute.value(3091,)
For 75 Assays
product.attribute(6,) product.attribute.value(3092,)
For 275 Assays
product.attribute(6,) product.attribute.value(3093,)
6 x 1L
product.attribute(6,) product.attribute.value(3122,)
1 x 1mL
product.attribute(6,) product.attribute.value(3123,)
1 x 5mL
product.attribute(6,) product.attribute.value(3124,)
5 x 1mL
product.attribute(6,) product.attribute.value(3125,)
5 x 5mL
product.attribute(6,) product.attribute.value(3126,)
8/pk
product.attribute(6,) product.attribute.value(3127,)
24/pk
product.attribute(6,) product.attribute.value(3128,)
96/pk
product.attribute(6,) product.attribute.value(3149,)
200/pk
product.attribute(6,) product.attribute.value(3150,)
500/pk
product.attribute(6,) product.attribute.value(3169,)
40/pk
product.attribute(6,) product.attribute.value(3170,)
1000/pk
product.attribute(6,) product.attribute.value(3218,)
6 x 5 mL
product.attribute(6,) product.attribute.value(3219,)
24 x 100 µL
product.attribute(6,) product.attribute.value(3240,)
125 mL
product.attribute(6,) product.attribute.value(3269,)
Each vial for 500mL medium
product.attribute(6,) product.attribute.value(3270,)
Each vial for 2L medium
product.attribute(6,) product.attribute.value(3315,)
50 μg
product.attribute(6,) product.attribute.value(3316,)
500 μg
product.attribute(6,) product.attribute.value(3317,)
5 mg
product.attribute(6,) product.attribute.value(3318,)
25 mg
product.attribute(6,) product.attribute.value(3319,)
50 mg
product.attribute(6,) product.attribute.value(3329,)
For 48 Tests
product.attribute(6,) product.attribute.value(3330,)
For 96 Tests
product.attribute(6,) product.attribute.value(3366,)
144/pk
product.attribute(6,) product.attribute.value(3367,)
Case of 144 x 10
product.attribute(6,) product.attribute.value(3375,)
5 x 1 mL, Sufficient for 500 Rxns
product.attribute(6,) product.attribute.value(3376,)
10 x 1 mL, Sufficient for 1000 Rxns
product.attribute(6,) product.attribute.value(3377,)
2 x 1 mL, Sufficient for 200 Rxns
product.attribute(6,) product.attribute.value(3378,)
10 kg Package
product.attribute(6,) product.attribute.value(3379,) product.attribute(6,) product.attribute.value(3380,) product.attribute(6,) product.attribute.value(3381,)
5000/Case
product.attribute(6,) product.attribute.value(3388,)
2.5 mL
product.attribute(6,) product.attribute.value(3399,)
100 UNITS
product.attribute(6,) product.attribute.value(3400,)
1 ampule
product.attribute(6,) product.attribute.value(3401,)
5 ampules
product.attribute(6,) product.attribute.value(3402,)
10 /µg
product.attribute(6,) product.attribute.value(3403,)
250 µg
product.attribute(6,) product.attribute.value(3407,)
1 x 250 mL
product.attribute(6,) product.attribute.value(3408,)
4 x 250 mL
product.attribute(6,) product.attribute.value(3409,)
Each vial for 100mL medium
product.attribute(6,) product.attribute.value(3456,)
Sterile, 5g
product.attribute(6,) product.attribute.value(3457,)
Sterile, 5kg
product.attribute(6,) product.attribute.value(3471,)
6/pk
product.attribute(6,) product.attribute.value(3473,)
For 10 Tests
product.attribute(6,) product.attribute.value(3484,)
50 ampoules x 1 mL + 10 negative controls
product.attribute(6,) product.attribute.value(3485,)
50 ampoules x 4 mL
product.attribute(6,) product.attribute.value(3486,)
20 ampoules x 4 mL
product.attribute(6,) product.attribute.value(3487,)
220 mL
product.attribute(6,) product.attribute.value(3488,)
700 mL
product.attribute(6,) product.attribute.value(3489,)
for 500 Tests
product.attribute(6,) product.attribute.value(3500,)
for 8 Tests
product.attribute(6,) product.attribute.value(3501,)
for 40 Tests
product.attribute(6,) product.attribute.value(3504,) product.attribute(6,) product.attribute.value(3505,)
5 x 50mg
product.attribute(6,) product.attribute.value(3527,)
50/Case
product.attribute(6,) product.attribute.value(3547,)
946 mL
product.attribute(6,) product.attribute.value(3552,)
10 x 3 mL
product.attribute(6,) product.attribute.value(3599,)
for 300 Tests
product.attribute(6,) product.attribute.value(3661,)
160/Case
product.attribute(6,) product.attribute.value(3662,)
10L, Sterile-filtered
product.attribute(6,) product.attribute.value(3667,)
R1: 1 x 12mL; R2a: 1 x 3.2mL; R2b: 1 x 0.625mL
product.attribute(6,) product.attribute.value(3668,)
R1: 1 x 12mL; R2: 2 x 4.2mL
product.attribute(6,) product.attribute.value(3756,)
2 x 96 Tests Plate
product.attribute(6,) product.attribute.value(3757,)
10 x 96 Tests Plate
product.attribute(6,) product.attribute.value(3758,)
4 x 50 mL
product.attribute(6,) product.attribute.value(3760,)
1.25 mL
product.attribute(6,) product.attribute.value(3761,)
6.25 mL
product.attribute(6,) product.attribute.value(3810,) product.attribute(6,) product.attribute.value(3811,) product.attribute(6,) product.attribute.value(3812,)
5 x 1 mL, sufficient for 1000 Rxns
product.attribute(6,) product.attribute.value(3814,)
1 x 0.5 mL, sufficient for 100 Rxns
product.attribute(6,) product.attribute.value(3841,)
2 x 50 mL
product.attribute(6,) product.attribute.value(3842,)
24 x 100 μL
product.attribute(6,) product.attribute.value(3845,)
60/Case
product.attribute(6,) product.attribute.value(3854,)
80/Case
product.attribute(6,) product.attribute.value(3862,)
10 μg
product.attribute(6,) product.attribute.value(3863,)
40 μg
product.attribute(6,) product.attribute.value(3864,)
100 μg
product.attribute(6,) product.attribute.value(3865,)
100L
product.attribute(6,) product.attribute.value(3866,)
4 mL
product.attribute(6,) product.attribute.value(3867,)
30 mg
product.attribute(6,) product.attribute.value(3868,)
6 x 30 mg
product.attribute(6,) product.attribute.value(3880,)
100 μL
product.attribute(6,) product.attribute.value(3881,)
4 x 100 μL
product.attribute(6,) product.attribute.value(3882,)
2 mg
product.attribute(6,) product.attribute.value(3883,)
For 200 Tests
product.attribute(6,) product.attribute.value(3884,)
20 µg
product.attribute(6,) product.attribute.value(3954,)
superfine, 20 - 50 µm, 100g
product.attribute(6,) product.attribute.value(3955,)
Fine, 20 - 80 µm, 100g
product.attribute(6,) product.attribute.value(3956,)
fFine, 20 - 80 µm, 500g
product.attribute(6,) product.attribute.value(3957,)
medium, 50 - 150 µm, 100g
product.attribute(6,) product.attribute.value(3958,)
medium. 50 - 150 µm, 500g
product.attribute(6,) product.attribute.value(3959,) product.attribute(6,) product.attribute.value(3960,)
Coarse Solid, >100 µm, 100g
product.attribute(6,) product.attribute.value(3961,)
Coarse Solid, >100 µm, 500g
product.attribute(6,) product.attribute.value(3991,)
200 μL
product.attribute(6,) product.attribute.value(3992,)
1000 μL
product.attribute(6,) product.attribute.value(3993,)
1 x 1 mL Bottle
product.attribute(6,) product.attribute.value(3994,)
10 x 100 μL Tubes
product.attribute(6,) product.attribute.value(4009,)
6 x 10 mL
product.attribute(6,) product.attribute.value(4010,)
5 x 2,000 UNITS
product.attribute(6,) product.attribute.value(4011,)
400 μL (400 reactions)
product.attribute(6,) product.attribute.value(4012,)
3 x 400 μL (1200 reactions)
product.attribute(6,) product.attribute.value(4013,)
5 x 1,500 units
product.attribute(6,) product.attribute.value(4014,)
1,500 Units
product.attribute(6,) product.attribute.value(4015,)
3,000 units
product.attribute(6,) product.attribute.value(4016,)
750 μL (750 reactions)
product.attribute(6,) product.attribute.value(4017,)
300 μL (300 reactions)
product.attribute(6,) product.attribute.value(4018,)
20 μL (20 Reactions)
product.attribute(6,) product.attribute.value(4019,)
50 μL (50 Reactions)
product.attribute(6,) product.attribute.value(4020,)
150 μL (150 Reactions)
product.attribute(6,) product.attribute.value(4021,)
250 μL (250 Reactions)
product.attribute(6,) product.attribute.value(4022,)
300 units
product.attribute(6,) product.attribute.value(4023,)
5 x 4,000 units
product.attribute(6,) product.attribute.value(4024,)
800 μL (800 Reactions)
product.attribute(6,) product.attribute.value(4025,)
5 x 500 μL (2,500 Reactions)
product.attribute(6,) product.attribute.value(4026,)
5 x 5,000 units
product.attribute(6,) product.attribute.value(4027,)
100 μL (100 Reactions)
product.attribute(6,) product.attribute.value(4028,) product.attribute(6,) product.attribute.value(4029,)
300 Strips
product.attribute(6,) product.attribute.value(4030,)
1500 Strips
product.attribute(6,) product.attribute.value(4031,)
2 µg
product.attribute(6,) product.attribute.value(4032,) product.attribute(6,) product.attribute.value(4033,) product.attribute(6,) product.attribute.value(4034,) product.attribute(6,) product.attribute.value(4035,)
1 x 10^6 cells
product.attribute(6,) product.attribute.value(4036,) product.attribute(6,) product.attribute.value(4037,) product.attribute(6,) product.attribute.value(4038,)
3.8 L
product.attribute(6,) product.attribute.value(4118,)
6 x 1 mL
product.attribute(6,) product.attribute.value(4119,)
Sufficient for 10 Blots
product.attribute(6,) product.attribute.value(4120,)
Sufficient for 40 Blots
product.attribute(6,) product.attribute.value(4152,)
10mM (1mL in DMSO)
product.attribute(6,) product.attribute.value(4201,)
24 UDI for 24 Samples
product.attribute(6,) product.attribute.value(4202,)
8 UDI for 8 Samples
product.attribute(6,) product.attribute.value(4213,)
2/pk
product.attribute(6,) product.attribute.value(4214,) product.attribute(6,) product.attribute.value(4215,) product.attribute(6,) product.attribute.value(4216,) product.attribute(6,) product.attribute.value(4220,)
4L
product.attribute(6,) product.attribute.value(4231,)
For 40,000 Preps
product.attribute(6,) product.attribute.value(4308,)
12 x 50 mL
product.attribute(6,) product.attribute.value(4329,)
Glass bottle, 1L
product.attribute(6,) product.attribute.value(4330,)
Plastic bottle, 1L
product.attribute(6,) product.attribute.value(4331,)
Glass bottle, 2.5L
product.attribute(6,) product.attribute.value(4332,)
Plastic bottle, 2.5L
product.attribute(6,) product.attribute.value(4333,)
Plastic bottle, 5L
product.attribute(6,) product.attribute.value(4334,)
Metal Drum, 25L
product.attribute(6,) product.attribute.value(4341,)
3 x 100 mL
product.attribute(6,) product.attribute.value(4342,)
3 x 500 mL
product.attribute(6,) product.attribute.value(4343,)
1,000,000 units
product.attribute(6,) product.attribute.value(4344,)
10,000,000 units
product.attribute(6,) product.attribute.value(4345,)
25,000,000 units
product.attribute(6,) product.attribute.value(4346,)
100,000,000 units
product.attribute(6,) product.attribute.value(4347,)
500,000 units
product.attribute(6,) product.attribute.value(4348,)
5,000,000 units
product.attribute(6,) product.attribute.value(4395,)
100 x 16.2 g
product.attribute(6,) product.attribute.value(4396,)
81 g
product.attribute(6,) product.attribute.value(4397,)
810 g bottle
product.attribute(6,) product.attribute.value(4398,)
200 Rxns kit only
product.attribute(6,) product.attribute.value(4399,)
1000 Rxns kit only
product.attribute(6,) product.attribute.value(4400,)
200 Rxns kit with RNase Inhibitor
product.attribute(6,) product.attribute.value(4401,)
1000 Rxns kit with RNase Inhibitor
product.attribute(6,) product.attribute.value(4402,)
2500 U
product.attribute(6,) product.attribute.value(4403,)
10,000 U
product.attribute(6,) product.attribute.value(4404,)
50 Rxns Kit only
product.attribute(6,) product.attribute.value(4405,)
500 Rxns Kit only
product.attribute(6,) product.attribute.value(4406,)
50 Rxns Kit with ezDnase
product.attribute(6,) product.attribute.value(4407,)
500 Rxns Kit with ezDnase
product.attribute(6,) product.attribute.value(4410,)
1 x 3.75 L
product.attribute(6,) product.attribute.value(4411,)
4 x 3.75 L
product.attribute(6,) product.attribute.value(4412,)
1 x 1L
product.attribute(6,) product.attribute.value(4413,)
1 x 50L
product.attribute(6,) product.attribute.value(4414,)
1 x 10L
product.attribute(6,) product.attribute.value(4415,)
40 μL for 20 Rxns
product.attribute(6,) product.attribute.value(4416,) product.attribute(6,) product.attribute.value(4417,)
200 μL for 100 Rxns
product.attribute(6,) product.attribute.value(4418,)
1 mL for 500 Rxns
product.attribute(6,) product.attribute.value(4419,)
480 Rxns
product.attribute(6,) product.attribute.value(4420,)
4 x 1 mL for 2000 Rxns
product.attribute(6,) product.attribute.value(4421,)
10 mL for 5000 Rxns
product.attribute(6,) product.attribute.value(4422,)
20 Rxns, Kit only
product.attribute(6,) product.attribute.value(4423,)
100 Rxns, Kit only
product.attribute(6,) product.attribute.value(4424,)
20 Rxns Kit with dsDNase
product.attribute(6,) product.attribute.value(4425,)
100 Rxns Kit with dsDNase
product.attribute(6,) product.attribute.value(4435,)
4 x 0.25 mL
product.attribute(6,) product.attribute.value(4436,)
4 x 1 mL
product.attribute(6,) product.attribute.value(4437,)
4 x 5 mL
product.attribute(6,) product.attribute.value(4457,)
2 X 1.25 mL for 250 Rxns
product.attribute(6,) product.attribute.value(4458,)
10 X 1.25 mL for 1250 Rxns
product.attribute(6,) product.attribute.value(4459,) product.attribute(6,) product.attribute.value(4460,) product.attribute(6,) product.attribute.value(4461,)
5 x 1,000 Units
product.attribute(6,) product.attribute.value(4462,)
150 reactions
product.attribute(6,) product.attribute.value(4463,)
11 x 50 μL
product.attribute(6,) product.attribute.value(4464,)
21 x 50 μL
product.attribute(6,) product.attribute.value(4465,)
42 x 50 μL
product.attribute(6,) product.attribute.value(4469,)
230g
product.attribute(6,) product.attribute.value(4470,)
5 x 230g
product.attribute(6,) product.attribute.value(4499,)
600 units
product.attribute(6,) product.attribute.value(4549,)
20 Tests Kit
product.attribute(6,) product.attribute.value(4550,)
100 Tests Kit
product.attribute(6,) product.attribute.value(4551,)
200 Tests Kit
product.attribute(6,) product.attribute.value(4552,)
MPN Predispensed In 10 mL Tubes, 100/pk
product.attribute(6,) product.attribute.value(4553,)
MPN Predispensed In 10 mL Tubes, 200/pk
product.attribute(6,) product.attribute.value(4566,)
Glass bottle, Safebreak®, 1 L
product.attribute(6,) product.attribute.value(4567,)
Glass bottle, Safebreak®, 2.5 L
product.attribute(6,) product.attribute.value(4568,)
Plastic drum, 20 L
product.attribute(6,) product.attribute.value(4569,)
Plastic drum, 200 L
product.attribute(6,) product.attribute.value(4570,)
200 L
product.attribute(6,) product.attribute.value(4581,)
50kg
product.attribute(6,) product.attribute.value(4595,)
100 mL, BSA: 2 mg/mL (Sufficient for 50 tube assays or 500 microplate assays)
product.attribute(6,) product.attribute.value(4600,)
5 x 10/pk
product.attribute(6,) product.attribute.value(4605,) product.attribute(6,) product.attribute.value(4606,) product.attribute(6,) product.attribute.value(4607,)
120mg
product.attribute(6,) product.attribute.value(4608,)
600mg
product.attribute(6,) product.attribute.value(4609,)
20 x 500 UNITS
product.attribute(6,) product.attribute.value(4615,)
10 µl
product.attribute(6,) product.attribute.value(4616,)
30 μl
product.attribute(6,) product.attribute.value(4617,)
300 µl
product.attribute(6,) product.attribute.value(4618,)
300 μl
product.attribute(6,) product.attribute.value(4619,)
1000 µl
product.attribute(6,) product.attribute.value(4620,)
5000 µl
product.attribute(6,) product.attribute.value(4621,)
10000 µl
product.attribute(6,) product.attribute.value(4649,)
12/case
product.attribute(6,) product.attribute.value(4650,)
1 x 250 mL Bottle
product.attribute(6,) product.attribute.value(4651,)
1 x 473 mL Spray Bottle
product.attribute(6,) product.attribute.value(4652,)
6 x 473 mL Spray Bottle
product.attribute(6,) product.attribute.value(4653,)
1 x 1 L Bottle
product.attribute(6,) product.attribute.value(4654,)
5 x 1 L Bottle
product.attribute(6,) product.attribute.value(4655,)
1 x 4 L Cubtainer
product.attribute(6,) product.attribute.value(4658,) product.attribute(6,) product.attribute.value(4660,)
100 mL of Phosphate standard solution
product.attribute(6,) product.attribute.value(4661,)
100 mL of Phosphate standard for ion chromatography
product.attribute(6,) product.attribute.value(4662,)
500 mL of Phosphate standard for ion chromatography
product.attribute(6,) product.attribute.value(4680,)
For 50 Assays
product.attribute(6,) product.attribute.value(4681,)
For 100 Assays
product.attribute(6,) product.attribute.value(4770,)
2 mL for 200 x 20µl Reactions
product.attribute(6,) product.attribute.value(4771,)
10 mL for 1,000 x 20µl Reactions
product.attribute(6,) product.attribute.value(4772,)
12.5 mL for 1,250 x 20µl Reactions
product.attribute(6,) product.attribute.value(4790,)
200 mL in PBS Buffer
product.attribute(6,) product.attribute.value(4791,)
3 X 200 mL in PBS Buffer
product.attribute(6,) product.attribute.value(4792,)
125 mL in TBS Buffer
product.attribute(6,) product.attribute.value(4802,)
3 x 1L
product.attribute(6,) product.attribute.value(4842,)
20/Box
product.attribute(6,) product.attribute.value(4843,)
100/Box
product.attribute(6,) product.attribute.value(4844,)
6 x 200 mL
product.attribute(6,) product.attribute.value(4845,)
120 Tests/Kit
product.attribute(6,) product.attribute.value(4846,)
400 Tests/Kit
product.attribute(6,) product.attribute.value(4961,)
2 x 25 mL
product.attribute(6,) product.attribute.value(4962,)
Droppers, 20 x 1 mL
product.attribute(6,) product.attribute.value(4963,)
Glass bottle, 500 mL
product.attribute(6,) product.attribute.value(4978,)
5000 mL Pack (Base medium + Supplement)
product.attribute(6,) product.attribute.value(4979,)
10 kg Pack (Base medium + Supplement)
product.attribute(6,) product.attribute.value(4980,)
25 L Pack (Base medium + Supplement)
product.attribute(6,) product.attribute.value(4981,)
5000 mL Pack (Base medium + MDR Supplement)
product.attribute(6,) product.attribute.value(4982,)
5000 mL Pack
product.attribute(6,) product.attribute.value(4983,)
25 L Pack
product.attribute(6,) product.attribute.value(4986,)
Glass bottle, 4L
product.attribute(6,) product.attribute.value(5005,)
10 Plates
product.attribute(6,) product.attribute.value(5015,) product.attribute(6,) product.attribute.value(5039,)
400 Units
product.attribute(6,) product.attribute.value(5053,)
Aluminium bottle, 5 L
product.attribute(6,) product.attribute.value(5054,)
Steel drum, 25 L
product.attribute(6,) product.attribute.value(5067,)
plastic drum, 25L
product.attribute(6,) product.attribute.value(5068,)
Glass bottle, 250 mL
product.attribute(6,) product.attribute.value(5069,)
Plastic bottle, 500 mL
product.attribute(6,) product.attribute.value(5075,)
Bag-in-box (Cubitainer), 5L
product.attribute(6,) product.attribute.value(5118,)
Metal drum with liner, 200L
product.attribute(6,) product.attribute.value(5128,)
20mM in H2O, 100 µl
product.attribute(6,) product.attribute.value(5171,)
40 mL
product.attribute(6,) product.attribute.value(5175,)
1 x 1 mL, sufficient for 250 Rxns
product.attribute(6,) product.attribute.value(5176,)
5 x 1 mL, sufficient for 1250 Rxns
product.attribute(6,) product.attribute.value(5177,)
10 x 1 mL, sufficient for 2500 Rxns
product.attribute(6,) product.attribute.value(5178,)
1 x 20 mL, sufficient for 5000 Rxns
product.attribute(6,) product.attribute.value(5179,)
0.1 mL, sufficient for 25 Rxns (free sample)
product.attribute(6,) product.attribute.value(5187,)
250 μL
product.attribute(6,) product.attribute.value(5188,)
Plastic bottle, 3.5L
product.attribute(6,) product.attribute.value(5209,)
plastic bottle, 1kg
product.attribute(6,) product.attribute.value(5210,)
Plastic bucket, 5kg
product.attribute(6,) product.attribute.value(5211,)
Plastic bucket, 25kg
product.attribute(6,) product.attribute.value(5212,)
Cardboard carton, 25kg
product.attribute(6,) product.attribute.value(5213,)
Plastic bottle, 5kg
product.attribute(6,) product.attribute.value(5214,)
Plastic container, 25kg
product.attribute(6,) product.attribute.value(5215,)
Plastic Container, 10L
product.attribute(6,) product.attribute.value(5218,)
Metal Drum, 200L
product.attribute(6,) product.attribute.value(5238,)
Plastic jerrican, 5L
product.attribute(6,) product.attribute.value(5263,)
100 x 20 mL pots with 10 mL Fixative Each
product.attribute(6,) product.attribute.value(5264,)
50 x 60 mL pots with 15 mL Fixative Each
product.attribute(6,) product.attribute.value(5285,)
Plastic Container, 5L
product.attribute(6,) product.attribute.value(5299,)
1 x 50 slides with 2 x 1 mL vials of Trypan blue stain
product.attribute(6,) product.attribute.value(5300,)
10 x 50 slides with 20 x 1 mL vials of Trypan blue stain
product.attribute(6,) product.attribute.value(5301,)
25 x 50 slides with 100 mL bottle of Trypan blue stain
product.attribute(6,) product.attribute.value(5302,)
50 x 50 slides with 100 mL bottle of Trypan blue stain
product.attribute(6,) product.attribute.value(5303,)
100 x 50 slides with 2 x 100 mL bottles of Trypan blue stain
product.attribute(6,) product.attribute.value(5343,)
50 µg with 1 mL Loading dye for 100 Applications
product.attribute(6,) product.attribute.value(5344,)
5 x 50 µg with 2 x 1 mL Loading dye for 500 Applications
product.attribute(6,) product.attribute.value(5380,)
1 x 112 tips package
product.attribute(6,) product.attribute.value(5381,)
10 x 112 tips package
product.attribute(6,) product.attribute.value(5397,)
2 x 500 UNITS
product.attribute(6,) product.attribute.value(5401,)
6 x 250 mL
product.attribute(6,) product.attribute.value(5413,)
Plastic bottle, 250 mL
product.attribute(6,) product.attribute.value(5427,)
120/pk
product.attribute(6,) product.attribute.value(5430,)
200 x 25 μL reactions.
product.attribute(6,) product.attribute.value(5431,)
1000 x 25 μL reactions
product.attribute(6,) product.attribute.value(5519,)
Plastic drum, 10kg
product.attribute(6,) product.attribute.value(5537,)
4 x 500 mL
product.attribute(6,) product.attribute.value(5607,)
10 x 1 mg
product.attribute(6,) product.attribute.value(5608,)
10 x 2 mg
product.attribute(6,) product.attribute.value(5609,)
20 mg
product.attribute(6,) product.attribute.value(5610,)
5 x 20 mg
product.attribute(6,) product.attribute.value(5620,)
3.75L
product.attribute(6,) product.attribute.value(5623,)
3 mL
product.attribute(6,) product.attribute.value(5624,)
30 x 9.3 mg
product.attribute(6,) product.attribute.value(5625,)
2 cartridges x 1 mL
product.attribute(6,) product.attribute.value(5626,)
1 cartridge x 5 mL
product.attribute(6,) product.attribute.value(5643,)
10 x 1 g
product.attribute(6,) product.attribute.value(5644,)
4/pk
product.attribute(6,) product.attribute.value(5647,)
96 Tips package
product.attribute(6,) product.attribute.value(5648,)
96 x 10 μL Tips
product.attribute(6,) product.attribute.value(5649,)
96 x 100 μL Tips
product.attribute(6,) product.attribute.value(5663,)
100 mg
product.attribute(6,) product.attribute.value(5664,)
1 g
product.attribute(6,) product.attribute.value(5665,)
5 x 50 μg
product.attribute(6,) product.attribute.value(5689,)
600 mL
product.attribute(6,) product.attribute.value(5690,)
For 20 Assays
product.attribute(6,) product.attribute.value(5691,)
For 180 Assays
product.attribute(6,) product.attribute.value(5692,)
for 80 Assays
product.attribute(6,) product.attribute.value(5693,)
for 400 Assays
product.attribute(6,) product.attribute.value(5694,) product.attribute(6,) product.attribute.value(5695,)
for 200 Assays
product.attribute(6,) product.attribute.value(5696,)
for 1000 Tests
product.attribute(6,) product.attribute.value(5697,)
4 x 500 μg
product.attribute(6,) product.attribute.value(5698,)
100 Reactions
product.attribute(6,) product.attribute.value(5707,)
8 x 1.25 mL
product.attribute(6,) product.attribute.value(5708,) product.attribute(6,) product.attribute.value(5709,)
6 x 1000 mL
product.attribute(6,) product.attribute.value(5710,)
10 L bag
product.attribute(6,) product.attribute.value(5711,)
20 L bag
product.attribute(6,) product.attribute.value(5712,)
1 L (ExpiSf CD Medium), 4 x 1 mL (ExpiSf Enhancer)
product.attribute(6,) product.attribute.value(5713,)
6 x 1000 mL (ExpiSf CD Medium), 24 x 1 mL (ExpiSf Enhancer)
product.attribute(6,) product.attribute.value(5714,)
10 L (ExpiSf CD Medium), 40 mL (ExpiSf Enhancer)
product.attribute(6,) product.attribute.value(5715,)
5 x 10 L (ExpiSf CD Medium), 5 x 40 mL (ExpiSf Enhancer)
product.attribute(6,) product.attribute.value(5716,)
0.3 mL
product.attribute(6,) product.attribute.value(5717,)
20 x 96 Tests Plate
product.attribute(6,) product.attribute.value(5724,)
25 μL
product.attribute(6,) product.attribute.value(5725,)
2 x 1 g
product.attribute(6,) product.attribute.value(5737,)
For 1000 Assays
product.attribute(6,) product.attribute.value(5744,)
96 Tests Plate
product.attribute(6,) product.attribute.value(5745,)
5 x 96 Tests Plates
product.attribute(6,) product.attribute.value(5746,)
10 x 96 Tests Plates
product.attribute(6,) product.attribute.value(5747,)
5 mL (102 × 20 mL pot)
product.attribute(6,) product.attribute.value(5748,)
25 mL (50 x 60 mL pot)
product.attribute(6,) product.attribute.value(5749,)
30 mL (50 x 70 mL pot)
product.attribute(6,) product.attribute.value(5750,)
80 mL (32 x 150 mL pot)
product.attribute(6,) product.attribute.value(5751,)
250 mL (1 x 500 mL pot)
product.attribute(6,) product.attribute.value(5752,)
500 mL (1 x 1 L pot)
product.attribute(6,) product.attribute.value(5753,)
4 x 1 L
product.attribute(6,) product.attribute.value(5754,)
200 mL Kit, for 5 mini blots
product.attribute(6,) product.attribute.value(5755,)
1 L Kit, for 25 mini blots
product.attribute(6,) product.attribute.value(5758,)
1 Kit
product.attribute(6,) product.attribute.value(5759,)
4 Kits
product.attribute(6,) product.attribute.value(5760,)
2 x 250 μL
product.attribute(6,) product.attribute.value(5761,)
8 x 250 μL
product.attribute(6,) product.attribute.value(5762,)
10 x 250 μL
product.attribute(6,) product.attribute.value(5763,)
50 μL
product.attribute(6,) product.attribute.value(5764,)
4 x 250 μL
product.attribute(6,) product.attribute.value(5765,) product.attribute(6,) product.attribute.value(5766,) product.attribute(6,) product.attribute.value(5773,)
25 x 125 μL Columns
product.attribute(6,) product.attribute.value(5774,)
25 x 500 μL Columns
product.attribute(6,) product.attribute.value(5775,)
5 x 2 mL Columns
product.attribute(6,) product.attribute.value(5776,)
5 x 4 mL Columns
product.attribute(6,) product.attribute.value(5777,)
2 x 96-well Plates
product.attribute(6,) product.attribute.value(5778,)
5 mL Resin, 54 Spin Columns
product.attribute(6,) product.attribute.value(5779,)
24 x 0.1 mL Columns
product.attribute(6,) product.attribute.value(5794,)
0.5 mL, Concentrate
product.attribute(6,) product.attribute.value(5795,)
1 mL, Concentrate
product.attribute(6,) product.attribute.value(5796,)
7 mL, pre-diluted
product.attribute(6,) product.attribute.value(5797,)
0.2 ml, 50 x 20 μl rxn, free sample
product.attribute(6,) product.attribute.value(5798,)
1 ml, 250 x 20 μl rxn
product.attribute(6,) product.attribute.value(5799,)
5 x 1ml, 1250 x 20 µl rxn
product.attribute(6,) product.attribute.value(5800,)
20 ml, 5000 x 20 μl rxn
product.attribute(6,) product.attribute.value(5801,)
25 U, free sample
product.attribute(6,) product.attribute.value(5802,)
100 U
product.attribute(6,) product.attribute.value(5803,)
500 U
product.attribute(6,) product.attribute.value(5804,)
1000 U
product.attribute(6,) product.attribute.value(5805,)
2000 U
product.attribute(6,) product.attribute.value(5806,)
20,000 U
product.attribute(6,) product.attribute.value(5807,)
50,000 U
product.attribute(6,) product.attribute.value(5808,)
100,000 U
product.attribute(6,) product.attribute.value(5809,)
100 rxn, free sample
product.attribute(6,) product.attribute.value(5810,)
5000 Reactions
product.attribute(6,) product.attribute.value(5811,)
1250 Reactions
product.attribute(6,) product.attribute.value(5812,)
2000 U, Sufficient for 100 Rxn
product.attribute(6,) product.attribute.value(5813,)
4000 U, Sufficient for 200 Rxn
product.attribute(6,) product.attribute.value(5814,)
10,000 U, Sufficient for 500 Rxn
product.attribute(6,) product.attribute.value(5815,)
100,000 U, Sufficient for 5000 Rxn
product.attribute(6,) product.attribute.value(5816,)
50 Rxn, free sample
product.attribute(6,) product.attribute.value(5817,)
25 mL, Sufficient for 5000 Rxns
product.attribute(6,) product.attribute.value(5818,) product.attribute(6,) product.attribute.value(5819,) product.attribute(6,) product.attribute.value(5820,)
1 x 5 mL, Sufficient for 1250 Rxns
product.attribute(6,) product.attribute.value(5821,)
4 x 5 mL, Sufficient for 5000 Rxns
product.attribute(6,) product.attribute.value(5822,)
1 x 50 mL, Sufficient for 12,500 Rxns
product.attribute(6,) product.attribute.value(5826,) product.attribute(6,) product.attribute.value(5827,)
5 x 200 UNITS
product.attribute(6,) product.attribute.value(5828,)
20,000 Units
product.attribute(6,) product.attribute.value(5829,)
2 mL for 100 Reactions
product.attribute(6,) product.attribute.value(5830,)
10 mL, Sufficient for 500 Rxns
product.attribute(6,) product.attribute.value(5831,)
200 Rxns Kit with ezDNase
product.attribute(6,) product.attribute.value(5836,)
Plastic bottle, 100 mL
product.attribute(6,) product.attribute.value(5842,)
Non sterile, Bulk packed, 300/case
product.attribute(6,) product.attribute.value(5843,)
Sterile, Individually wrapped, 250/case
product.attribute(6,) product.attribute.value(5844,)
Sterile, Bulk packed, 300/case
product.attribute(6,) product.attribute.value(5847,)
Dispenser box, 50 wipes
product.attribute(6,) product.attribute.value(5848,)
Refill sachets, 5 × 50 wipes
product.attribute(6,) product.attribute.value(5864,) product.attribute(6,) product.attribute.value(5867,)
1 UNIT
product.attribute(6,) product.attribute.value(5868,)
2 UNITS
product.attribute(6,) product.attribute.value(5871,)
200 Tablets (0.5 g each)
product.attribute(6,) product.attribute.value(5872,)
1000 Tablets (0.5 g each)
product.attribute(6,) product.attribute.value(5873,)
10 x 50 µg
product.attribute(6,) product.attribute.value(5874,)
500 Applications
product.attribute(6,) product.attribute.value(5875,)
2000 Applications
product.attribute(6,) product.attribute.value(5876,)
For 960 Preps
product.attribute(6,) product.attribute.value(5880,)
10 × 100 mL sirop bottles
product.attribute(6,) product.attribute.value(5881,)
10 × 500 mL sirop bottles
product.attribute(6,) product.attribute.value(5882,)
24 × 10 mL plastic universal bottles
product.attribute(6,) product.attribute.value(5883,)
100 × 10 mL plastic universal bottles
product.attribute(6,) product.attribute.value(5884,)
4 Preps
product.attribute(6,) product.attribute.value(5885,)
10 Preps
product.attribute(6,) product.attribute.value(5886,)
25 Preps
product.attribute(6,) product.attribute.value(5887,)
4 x 96 Preps
product.attribute(6,) product.attribute.value(5888,)
24 x 96 Preps
product.attribute(6,) product.attribute.value(5892,)
5 x 300 μL
product.attribute(6,) product.attribute.value(5904,)
8,000 Units
product.attribute(6,) product.attribute.value(5905,)
5 x 500 μL (2500 reactions)
product.attribute(6,) product.attribute.value(5906,)
200 μL (200 Reactions)
product.attribute(6,) product.attribute.value(5925,) product.attribute(6,) product.attribute.value(5926,) product.attribute(6,) product.attribute.value(5927,)
0.5 mg
product.attribute(6,) product.attribute.value(5942,)
3 x 100 mg
product.attribute(6,) product.attribute.value(5990,)
MDR-TB Verification & Control Panel (Sputum)
product.attribute(6,) product.attribute.value(5991,)
MTB Control (Sputum)
product.attribute(6,) product.attribute.value(5992,)
MTB INH Resistant (Sputum)
product.attribute(6,) product.attribute.value(5993,)
MTB RIF Resistant Control (Sputum)
product.attribute(6,) product.attribute.value(6109,) product.attribute(6,) product.attribute.value(6293,)
500 mL Bottle (Non-irradiated)
product.attribute(6,) product.attribute.value(6294,)
500 mL Bottle (Gamma-irradiated)
product.attribute(6,) product.attribute.value(6295,)
50 mL One Shot (Non-irradiated)
product.attribute(6,) product.attribute.value(6296,)
10 × 50 mL One Shot Pack (Non-irradiated)
product.attribute(6,) product.attribute.value(6297,)
4 x 10^6
product.attribute(6,) product.attribute.value(6298,)
300 mg
product.attribute(6,) product.attribute.value(6299,)
500 mg
product.attribute(6,) product.attribute.value(6300,)
2 x 20 mL, Sufficient for 10,000 Rxns
product.attribute(6,) product.attribute.value(6301,)
1 x 100 mL, Sufficient for 25,000 Rxns
product.attribute(6,) product.attribute.value(6302,)
2 x 100 mL, Sufficient for 50,000 Rxns
product.attribute(6,) product.attribute.value(6547,)
Dehydrated Medium, 100 g
product.attribute(6,) product.attribute.value(6548,)
Dehydrated Medium, 500 g
product.attribute(6,) product.attribute.value(6549,)
Dehydrated Medium, 5kg
product.attribute(6,) product.attribute.value(6550,)
Liquid in tubes (10 × 10 mL)
product.attribute(6,) product.attribute.value(6551,)
Liquid in tubes (20 × 10 mL)
product.attribute(6,) product.attribute.value(6552,) product.attribute(6,) product.attribute.value(6553,)
Liquid in Bottles (6 × 100 mL)
product.attribute(6,) product.attribute.value(6554,)
Powder, 500g
product.attribute(6,) product.attribute.value(6555,)
Bottles (6 × 90 mL, screw cap)
product.attribute(6,) product.attribute.value(6556,)
Bottles (6 × 100 mL, screw cap)
product.attribute(6,) product.attribute.value(6557,)
Bottles (6 × 300 mL, screw cap)
product.attribute(6,) product.attribute.value(6558,)
Bottles (6 × 1000 mL, perforable cap)
product.attribute(6,) product.attribute.value(6559,)
Bags (3 × 3 L)
product.attribute(6,) product.attribute.value(6567,)
90 mm Plates, 20/box
product.attribute(6,) product.attribute.value(6569,)
15 mg
product.attribute(6,) product.attribute.value(6614,)
4 x 5 mL, sufficient for 800 Rxns
product.attribute(6,) product.attribute.value(6615,)
1 mL in 2 mL tube
product.attribute(6,) product.attribute.value(6616,)
1.5 mL in 3 mL tube
product.attribute(6,) product.attribute.value(6617,)
1.5 mL in 5 mL tube
product.attribute(6,) product.attribute.value(6628,)
4 x 1.125 mL, Sufficient for 100 Rxns
product.attribute(6,) product.attribute.value(6629,)
4 x 56.25 mL, Sufficient for 5000 Rxns
product.attribute(6,) product.attribute.value(6636,)
100 × 50 µL reactions
product.attribute(6,) product.attribute.value(6637,)
500 × 50 µL reactions
product.attribute(6,) product.attribute.value(6761,)
1 x 20 μg
product.attribute(6,) product.attribute.value(6762,)
5 x 20 μg
product.attribute(6,) product.attribute.value(6766,)
4 x 96 Tests Kit
product.attribute(6,) product.attribute.value(6767,)
10 x 96 Tests Kit
product.attribute(6,) product.attribute.value(6768,)
Metal Drum, 10L
product.attribute(6,) product.attribute.value(6772,) product.attribute(6,) product.attribute.value(6773,)
20 x 20 mL
product.attribute(6,) product.attribute.value(6775,)
5000/pk
product.attribute(6,) product.attribute.value(6836,)
2 × 1.25 mL, Sufficient for 100 reactions
product.attribute(6,) product.attribute.value(6837,)
10 × 1.25 mL, Sufficient for 500 reactions
product.attribute(6,) product.attribute.value(6838,)
4 x 10,000 Units
product.attribute(6,) product.attribute.value(6892,)
5 x 1 mg
product.attribute(6,) product.attribute.value(6905,)
6/Case
product.attribute(6,) product.attribute.value(6906,)
1 Each
product.attribute(6,) product.attribute.value(6907,)
4/case
product.attribute(6,) product.attribute.value(6912,)
8 Liters
product.attribute(6,) product.attribute.value(6918,)
25 Tests Kit
product.attribute(6,) product.attribute.value(6919,)
50 Tests Kit
product.attribute(6,) product.attribute.value(6943,)
24 Preps
product.attribute(6,) product.attribute.value(6944,)
96 Preps
product.attribute(6,) product.attribute.value(7000,)
10 x 7 mL Tubes
product.attribute(6,) product.attribute.value(7004,)
500 Preps
product.attribute(6,) product.attribute.value(7005,)
2500 Preps
product.attribute(6,) product.attribute.value(7012,)
25 Units
product.attribute(6,) product.attribute.value(7013,)
125 Units
product.attribute(6,) product.attribute.value(7014,)
140 mm Plates, 10/box
product.attribute(6,) product.attribute.value(7032,)
500 mL, Glass bottle
product.attribute(6,) product.attribute.value(7033,)
6 x 500 mL, Glass bottle
product.attribute(6,) product.attribute.value(7034,)
6 x 1L, Glass bottle
product.attribute(6,) product.attribute.value(7035,)
1 L, Smart Chemical glass bottle with RFID
product.attribute(6,) product.attribute.value(7036,)
6 x 1 L, Smart Chemical glass bottle with RFID
product.attribute(6,) product.attribute.value(7037,)
4 × 2.5 L, Glass bottles
product.attribute(6,) product.attribute.value(7038,)
100 mL, Glass bottle, narrow mouth
product.attribute(6,) product.attribute.value(7039,)
6 X 100 mL, Glass bottle, narrow mouth
product.attribute(6,) product.attribute.value(7040,)
10 × 5 mL
product.attribute(6,) product.attribute.value(7041,)
6 × (10 × 5 mL)
product.attribute(6,) product.attribute.value(7044,)
250 mg
product.attribute(6,) product.attribute.value(7045,)
10 mg
product.attribute(6,) product.attribute.value(7048,)
5 x 3,000 units
product.attribute(6,) product.attribute.value(7077,)
25 g
product.attribute(6,) product.attribute.value(7078,)
100 g
product.attribute(6,) product.attribute.value(7201,)
500 g
product.attribute(6,) product.attribute.value(7202,)
5 mL × 6
product.attribute(6,) product.attribute.value(7203,)
5 mL × 24
product.attribute(6,) product.attribute.value(7213,)
5 g
product.attribute(6,) product.attribute.value(7234,) product.attribute(6,) product.attribute.value(7235,)
Each vial for 2.25L medium
product.attribute(6,) product.attribute.value(7272,)
10 × 0.6 mL
product.attribute(6,) product.attribute.value(7273,)
10 mL Glass bottle
product.attribute(6,) product.attribute.value(7274,)
10 mL Glass bottle with septum cap
product.attribute(6,) product.attribute.value(7275,)
25 mL Glass bottle
product.attribute(6,) product.attribute.value(7276,)
100 mL Glass bottle
product.attribute(6,) product.attribute.value(7277,)
500 mL Glass bottle
product.attribute(6,) product.attribute.value(7294,)
Aluminium bottle, 10 L
Description
product.attribute(14,) product.attribute.value(471,)
15mL, 25/Pk
product.attribute(14,) product.attribute.value(472,)
50mL, 25/Pk
product.attribute(14,) product.attribute.value(473,) product.attribute(14,) product.attribute.value(474,) product.attribute(14,) product.attribute.value(494,)
With Filter cap, 25cm2
product.attribute(14,) product.attribute.value(495,)
With Filter Cap, 75cm2
product.attribute(14,) product.attribute.value(496,)
With Filter Cap, 175cm2
product.attribute(14,) product.attribute.value(497,)
With plugged Cap, 25cm2
product.attribute(14,) product.attribute.value(498,)
With plugged Cap, 75cm2
product.attribute(14,) product.attribute.value(499,)
With plugged Cap, 175cm2
product.attribute(14,) product.attribute.value(541,) product.attribute(14,) product.attribute.value(641,) product.attribute(14,) product.attribute.value(642,) product.attribute(14,) product.attribute.value(643,) product.attribute(14,) product.attribute.value(664,)
5 x 100 mL
product.attribute(14,) product.attribute.value(665,)
10 x 50 mL
product.attribute(14,) product.attribute.value(666,)
1 x 100 mL
product.attribute(14,) product.attribute.value(667,)
1 x 500 mL
product.attribute(14,) product.attribute.value(668,)
1 x 1,000 mL
product.attribute(14,) product.attribute.value(669,)
4 x 1,000 mL
product.attribute(14,) product.attribute.value(803,)
30 mL with Patient ID Label for Urine Sample
product.attribute(14,) product.attribute.value(804,)
30 mL with Spoon & Patient ID Label for Stool Sample
product.attribute(14,) product.attribute.value(805,)
60 mL with Patient ID Label for Urine Sample
product.attribute(14,) product.attribute.value(806,) product.attribute(14,) product.attribute.value(807,)
100 mL for gnerel purpose
product.attribute(14,) product.attribute.value(808,)
120 mL for gnerel purpose
product.attribute(14,) product.attribute.value(816,)
Single Frosted End
product.attribute(14,) product.attribute.value(817,)
Double Frosted End
product.attribute(14,) product.attribute.value(818,)
Plain, Non Frosted
product.attribute(14,) product.attribute.value(1800,)
Vortex-Genie® 1, Speed range: 2700 fixed
product.attribute(14,) product.attribute.value(1801,)
Vortex-Genie® 2, Speed range: 600 - 2700
product.attribute(14,) product.attribute.value(1802,)
Vortex-Genie® 2T, Speed range: 600 - 2700, With timer function; touch-on 1 to 60 seconds, hands-free 1 to 60 minutes or continuous
product.attribute(14,) product.attribute.value(1828,) product.attribute(14,) product.attribute.value(1829,) product.attribute(14,) product.attribute.value(1830,) product.attribute(14,) product.attribute.value(1831,) product.attribute(14,) product.attribute.value(562,) product.attribute(14,) product.attribute.value(1369,)
Round tip, 180mm
product.attribute(14,) product.attribute.value(3207,)
SYTO 12 Green Fluorescent Nucleic Acid Stain, 4 mM Solution in DMSO, 315 µL
product.attribute(14,) product.attribute.value(7019,)
1 g Bed Weight; 6 mL Column Volume, 30/pk
product.attribute(14,) product.attribute.value(7031,)
500 mg bed weight; 3 mL Column Volume, 50/Pk
product.attribute(14,) product.attribute.value(563,) product.attribute(14,) product.attribute.value(1370,)
Round tip, 125mm
product.attribute(14,) product.attribute.value(3208,)
SYTO 13 Green Fluorescent Nucleic Acid Stain, 5 mM Solution in DMSO, 250 µL
product.attribute(14,) product.attribute.value(3320,)
Gel Percentage: 1%; Separation Range: 100 to 5000 bp, 10 Gels/Pk.
product.attribute(14,) product.attribute.value(3321,)
Gel Percentage: 1%; Separation Range: 100 to 5000 bp, 20 Gels/Pk.
product.attribute(14,) product.attribute.value(3322,)
Gel Percentage: 2%; Separation Range: 50 to 2000 bp, 10 Gels/Pk.
product.attribute(14,) product.attribute.value(3323,)
Gel Percentage: 2%; Separation Range: 50 to 2000 bp, 20 Gels/Pk.
product.attribute(14,) product.attribute.value(3324,)
Gel Percentage: 4%; Separation Range: 20 to 800 bp, 10 Gels/Pk.
product.attribute(14,) product.attribute.value(5022,)
Plugged-Seal Cap, 15 mL, Racked, 25/Pk
product.attribute(14,) product.attribute.value(5023,)
Plugged-Seal Cap, 50 mL, Racked, 25/Pk
product.attribute(14,) product.attribute.value(5024,)
Flat Top Cap, 15mL, Racked, 25/Pk
product.attribute(14,) product.attribute.value(5025,)
Flat Top Cap, 50 mL, Racked, 25/Pk
product.attribute(14,) product.attribute.value(5026,)
Flat Top Cap, 15mL, Bulk packed, 25/Pk
product.attribute(14,) product.attribute.value(5027,)
Flat Top Cap, 50 mL, Bulk packed, 25/Pk
product.attribute(14,) product.attribute.value(7020,)
100 mg Bed Weight; 1 mL Column Volume, 100/pk
product.attribute(14,) product.attribute.value(568,) product.attribute(14,) product.attribute.value(1581,)
pH 1.00, Colourless, Glycine, 1000mL
product.attribute(14,) product.attribute.value(3209,)
SYTO 14 Green Fluorescent Nucleic Acid Stain, 5 mM Solution in DMSO, 250 µL
product.attribute(14,) product.attribute.value(7021,)
200 mg Bed Weight; 3 mL Column Volume, 50/pk
product.attribute(14,) product.attribute.value(569,) product.attribute(14,) product.attribute.value(1582,)
pH 2.00, Colourless, Citrate, 500mL
product.attribute(14,) product.attribute.value(3210,)
SYTO 16 Green Fluorescent Nucleic Acid Stain, 1 mM Solution in DMSO, 250 µL
product.attribute(14,) product.attribute.value(7022,)
500 mg Bed Weight; 6 mL Column Volume, 30/pk
product.attribute(14,) product.attribute.value(659,) product.attribute(14,) product.attribute.value(1583,)
pH 2.00, Colourless, Citrate, 1000mL
product.attribute(14,) product.attribute.value(3211,)
SYTO 21 Green Fluorescent Nucleic Acid Stain, 5 mM Solution in DMSO, 250 µL
product.attribute(14,) product.attribute.value(7023,)
50 mg bed weight, 1 mL column volume, 100/pk
product.attribute(14,) product.attribute.value(660,) product.attribute(14,) product.attribute.value(1584,)
pH 3.00, Colourless, Citrate, 1000mL
product.attribute(14,) product.attribute.value(3212,)
SYTO 24 Green Fluorescent Nucleic Acid Stain, 5 mM Solution in DMSO, 250 µL
product.attribute(14,) product.attribute.value(7024,)
2 g Bed Weight; 15 mL Column Volume, 20/pk
product.attribute(14,) product.attribute.value(661,) product.attribute(14,) product.attribute.value(1585,)
pH 4.66, Colourless, Acetate, 500mL
product.attribute(14,) product.attribute.value(3213,)
SYTO BC Green Fluorescent Nucleic Acid Stain, 100 µL
product.attribute(14,) product.attribute.value(7025,)
5 g Bed Weight; 25 mL Column Volume, 20/pk
product.attribute(14,) product.attribute.value(662,) product.attribute(14,) product.attribute.value(1586,)
pH 4.66, Colourless, Acetate, 1000mL
product.attribute(14,) product.attribute.value(3214,)
SYTO RNASelect Green Fluorescent Cell Stain, 5 mM Solution in DMSO, 100 µL
product.attribute(14,) product.attribute.value(7026,)
10 g Bed Weight; 75 mL Column Volume, 10/pk
product.attribute(14,) product.attribute.value(663,) product.attribute(14,) product.attribute.value(1587,)
pH 5.00, Colourless, Citrate, 1000mL
product.attribute(14,) product.attribute.value(3215,)
1 kit SYTO Green Fluorescent Nucleic Acid Stain Sampler Kit #1: SYTO dyes 11, 14, 16, 21, 24 (50 μL each)
product.attribute(14,) product.attribute.value(7027,)
1 g bed weight; 15 mL column volume, 20/Pk
product.attribute(14,) product.attribute.value(873,) product.attribute(14,) product.attribute.value(1588,)
pH 6.00, Colourless, Citrate, 1000mL
product.attribute(14,) product.attribute.value(7028,)
100 mg bed weight; 3 mL column volume, 50/Pk
product.attribute(14,) product.attribute.value(874,) product.attribute(14,) product.attribute.value(1589,)
pH 6.88, Colourless, Phosphate, 1000mL
product.attribute(14,) product.attribute.value(7029,)
2 g bed weight; 25 mL column volume, 20/Pk
product.attribute(14,) product.attribute.value(878,)
PTFE coated needles, 76mm long
product.attribute(14,) product.attribute.value(1590,)
pH 6.88, Colourless, Phosphate, 500mL
product.attribute(14,) product.attribute.value(7030,)
25 mg bed weight; 1 mL column volume, 100/Pk
product.attribute(14,) product.attribute.value(875,) product.attribute(14,) product.attribute.value(1591,)
pH 7.00, Colourless, Phosphate, 1000mL
product.attribute(14,) product.attribute.value(876,)
Needles, 76mm long
product.attribute(14,) product.attribute.value(1592,)
pH 8.00, Colourless, Borate, 1000mL
product.attribute(14,) product.attribute.value(877,)
needles, 127mm long
product.attribute(14,) product.attribute.value(1784,)
CoolCell® LX, exposed tops for 12 standard 1.0 mL to 2.0 mL cryogenic vials, Purple
product.attribute(14,) product.attribute.value(879,)
PTFE coated needles, 127mm long
product.attribute(14,) product.attribute.value(1785,)
CoolCell® LX, exposed tops for 12 standard 1.0 mL to 2.0 mL cryogenic vials, Green
product.attribute(14,) product.attribute.value(1144,)
Used for 30 , 35 , 50L container , with 4 castors
product.attribute(14,) product.attribute.value(1786,)
CoolCell® LX, exposed tops for 12 standard 1.0 mL to 2.0 mL cryogenic vials, Orange
product.attribute(14,) product.attribute.value(1145,)
Used for 47L container , with 4 castors
product.attribute(14,) product.attribute.value(1787,)
CoolCell® LX, exposed tops for 12 standard 1.0 mL to 2.0 mL cryogenic vials, Pink
product.attribute(14,) product.attribute.value(1146,)
Used for 65~175L container , with 4 Castors
product.attribute(14,) product.attribute.value(1788,)
CoolCell® LX, exposed tops for 12 standard 1.0 mL to 2.0 mL cryogenic vials (each one purple, orange, green and pink), Assorted colours, 4/pk
product.attribute(14,) product.attribute.value(1298,)
For 15mL Centrifuge Tubes, 25-Well
product.attribute(14,) product.attribute.value(1789,)
CoolCell® FTS30, exposed tops for 30x1 ml or 2 ml cryogenic vials, Purple
product.attribute(14,) product.attribute.value(1299,)
For 50 mL Centrifuge Tubes, 25-Well
product.attribute(14,) product.attribute.value(1790,)
CoolCell® FTS30, exposed tops for 30x1 ml or 2 ml cryogenic vials, Orange
product.attribute(14,) product.attribute.value(1322,)
Round tips, 150mm
product.attribute(14,) product.attribute.value(1791,)
CoolCell® FTS30, exposed tops for 30x1 ml or 2 ml cryogenic vials, Green
product.attribute(14,) product.attribute.value(1323,)
Fine tip, 120mm
product.attribute(14,) product.attribute.value(1792,)
CoolCell® FTS30, exposed tops for 30x1 ml or 2 ml cryogenic vials, Pink
product.attribute(14,) product.attribute.value(1324,)
Round tip, 200mm
product.attribute(14,) product.attribute.value(1793,)
CoolCell® 5 ml LX, exposed tops for 12x3.5 mL to 5 mL cryogenic vials, Purple
product.attribute(14,) product.attribute.value(1328,)
Milk, 0-20%
product.attribute(14,) product.attribute.value(1794,)
CoolCell® SV10, exposed tops for 6 standard 10.0 mL injectable ampules, Purple
product.attribute(14,) product.attribute.value(1329,)
Salinity, 0 - 100%
product.attribute(14,) product.attribute.value(1795,)
CoolCell® SV2, exposed tops for 12 standard 2.0 mL injectable ampules, Purple
product.attribute(14,) product.attribute.value(1330,)
Sugar, 0-80%
product.attribute(14,) product.attribute.value(1966,)
Now Wash your Hands, 300x100mm
product.attribute(14,) product.attribute.value(1331,)
Sodium Chloride, 0-28%
product.attribute(14,) product.attribute.value(1967,)
Eye Protection must be worn in area, 300x100mm
product.attribute(14,) product.attribute.value(1332,)
Alcohol, 0 - 80%
product.attribute(14,) product.attribute.value(1968,)
Protective gloves must be worn, 300x100mm
product.attribute(14,) product.attribute.value(1367,)
140mm
product.attribute(14,) product.attribute.value(1969,)
Protective clothing must be worn, 300x100mm
product.attribute(14,) product.attribute.value(1368,)
160mm
product.attribute(14,) product.attribute.value(1970,)
Wear Face Mask, 300x100mm
product.attribute(14,) product.attribute.value(1531,)
UV to white light converter screen, 200×200 mm
product.attribute(14,) product.attribute.value(1971,)
First Aid, 200x300mm
product.attribute(14,) product.attribute.value(1532,)
UV to blue light conversion screen 210×260 mm
product.attribute(14,) product.attribute.value(1560,) product.attribute(14,) product.attribute.value(1561,) product.attribute(14,) product.attribute.value(1603,)
60 mL, Clear, Certified
product.attribute(14,) product.attribute.value(1604,)
120 mL, Amber, Certified
product.attribute(14,) product.attribute.value(1605,)
125 mL, Clear, Certified
product.attribute(14,) product.attribute.value(1607,) product.attribute(14,) product.attribute.value(199,)
Socket 24/29, cone 19/26, thimble size: 18×55 mm, 20 ml
product.attribute(14,) product.attribute.value(200,)
Socket 29/32, cone 24/29, thimble size: 22×80 mm, 40 ml
product.attribute(14,) product.attribute.value(201,)
Socket 34/35, cone 24/29, thimble size: 28×80 mm, 60 ml
product.attribute(14,) product.attribute.value(202,)
Socket 34/35, cone 34/35, thimble size: 28×120 mm, 100 ml
product.attribute(14,) product.attribute.value(203,)
Socket 40/38, cone 24/29, thimble size: 33×100 mm, 100 ml
product.attribute(14,) product.attribute.value(204,)
Socket 50/42, cone 24/29, thimble size: 41×123 mm, 200 ml
product.attribute(14,) product.attribute.value(234,)
With standard penetration probe
product.attribute(14,) product.attribute.value(235,)
Without Probe
product.attribute(14,) product.attribute.value(258,)
With -40℃ ~ + 120℃ sensor probe
product.attribute(14,) product.attribute.value(259,)
With PT 100 sensor -200°C ~ +150°C for Cryogenic freezers
product.attribute(14,) product.attribute.value(260,) product.attribute(14,) product.attribute.value(266,)
Clear, 25 mL
product.attribute(14,) product.attribute.value(267,)
Clear, 10 mL
product.attribute(14,) product.attribute.value(268,)
Clear, 50 mL
product.attribute(14,) product.attribute.value(269,)
Amber, 25 mL
product.attribute(14,) product.attribute.value(270,)
Amber, 10 mL
product.attribute(14,) product.attribute.value(271,)
Amber, 50 mL
product.attribute(14,) product.attribute.value(272,)
pH 7.0, Colourless, 500mL
product.attribute(14,) product.attribute.value(273,)
pH 9.0, Blue, 500mL
product.attribute(14,) product.attribute.value(274,)
pH 4.0, Red, 500mL
product.attribute(14,) product.attribute.value(275,)
pH 10.0, Colourless, 500mL
product.attribute(14,) product.attribute.value(321,) product.attribute(14,) product.attribute.value(322,) product.attribute(14,) product.attribute.value(323,) product.attribute(14,) product.attribute.value(354,)
10µl, box of 960 Tips
product.attribute(14,) product.attribute.value(355,)
20µl, box of 960 Tips
product.attribute(14,) product.attribute.value(356,)
50µl, box of 960 Tips
product.attribute(14,) product.attribute.value(357,)
100µl, box of 960 Tips
product.attribute(14,) product.attribute.value(358,)
200µl, box of 960 Tips
product.attribute(14,) product.attribute.value(359,)
1000µl, box of 768 Tips
product.attribute(14,) product.attribute.value(386,)
For Gram Negative Isolates (GN1)
product.attribute(14,) product.attribute.value(387,)
For Gram Positive Isolates (GP1)
product.attribute(14,) product.attribute.value(388,)
For Urinary Tract Isolates (UTI)
product.attribute(14,) product.attribute.value(389,) product.attribute(14,) product.attribute.value(390,) product.attribute(14,) product.attribute.value(391,)
3510 pH and Temperature
product.attribute(14,) product.attribute.value(392,)
3540 Combined Conductivity/pH/Temperature
product.attribute(14,) product.attribute.value(396,) product.attribute(14,) product.attribute.value(397,) product.attribute(14,) product.attribute.value(398,)
Sodium Na 1000ppm, 500mL
product.attribute(14,) product.attribute.value(399,)
Potassium K 1000ppm, 500mL
product.attribute(14,) product.attribute.value(400,)
Calcium Ca 1000ppm, 500mL
product.attribute(14,) product.attribute.value(401,)
Lithium Li 1000ppm, 500mL
product.attribute(14,) product.attribute.value(402,)
Barium Ba 1000ppm, 500mL
product.attribute(14,) product.attribute.value(407,)
P system starter setup
product.attribute(14,) product.attribute.value(408,)
P TOC system starter setup
product.attribute(14,) product.attribute.value(428,)
10µL
product.attribute(14,) product.attribute.value(429,)
1µL
product.attribute(14,) product.attribute.value(439,) product.attribute(14,) product.attribute.value(440,)
Green, 10mL
product.attribute(14,) product.attribute.value(441,)
Blue, 2mL
product.attribute(14,) product.attribute.value(442,)
Red, 25mL
product.attribute(14,) product.attribute.value(540,) product.attribute(14,) product.attribute.value(1608,)
for Glass Beakers, Autoclavable
product.attribute(14,) product.attribute.value(1609,) product.attribute(14,) product.attribute.value(1610,) product.attribute(14,) product.attribute.value(1611,) product.attribute(14,) product.attribute.value(1624,)
Fixed Angle, 5 to 60 rpm
product.attribute(14,) product.attribute.value(1625,)
Digital, Multi-function, 1 to 100 rpm
product.attribute(14,) product.attribute.value(1649,)
With Screw cap
product.attribute(14,) product.attribute.value(1650,)
Without cap
product.attribute(14,) product.attribute.value(1656,) product.attribute(14,) product.attribute.value(1657,) product.attribute(14,) product.attribute.value(1658,) product.attribute(14,) product.attribute.value(1659,) product.attribute(14,) product.attribute.value(1660,) product.attribute(14,) product.attribute.value(1661,) product.attribute(14,) product.attribute.value(1662,) product.attribute(14,) product.attribute.value(1663,) product.attribute(14,) product.attribute.value(1664,) product.attribute(14,) product.attribute.value(1765,)
ABI style, 0.1mL, Clear
product.attribute(14,) product.attribute.value(1766,)
ABI style, 0.2mL, Clear
product.attribute(14,) product.attribute.value(1767,)
ABI FAST® style, 0.1mL, Clear
product.attribute(14,) product.attribute.value(1768,)
LightCycler style, 0.1mL, Clear
product.attribute(14,) product.attribute.value(1769,)
LightCycler style, 0.1mL, White
product.attribute(14,) product.attribute.value(1783,)
CoolCell®, fully covered tops, For 12 standard 1.0 mL to 2.0 mL cryogenic vials
product.attribute(14,) product.attribute.value(1814,)
Speed of Evacuation: 12 L/Min with 1 pump head, Ultimate pressure: 0.075 Mpa
product.attribute(14,) product.attribute.value(1815,)
Speed of Evacuation 30 L/Min with 2 pump head, Ultimate pressure: 0.095 Mpa,
product.attribute(14,) product.attribute.value(1816,)
Speed of Evacuation: 20 L/Min with 1 pump head, Ultimate pressure: 0.08 Mpa,
product.attribute(14,) product.attribute.value(1817,)
Speed of Evacuation: 60 L/Min with 1 pump head, Ultimate pressure: 0.08 Mpa,
product.attribute(14,) product.attribute.value(1818,)
Without interrupter
product.attribute(14,) product.attribute.value(1819,)
with interrupter, thrust: <14N
product.attribute(14,) product.attribute.value(1840,)
Primary Standards for AQ4500, SDVB for 0, 1.0, 10, 100, 1000NTU
product.attribute(14,) product.attribute.value(1841,)
Formazin turbidity standard, 4000NTU, 475mL
product.attribute(14,) product.attribute.value(1842,)
Silicon Oil and Cloth Kit
product.attribute(14,) product.attribute.value(1843,)
Replacement Turbidity Vials, 12/pk
product.attribute(14,) product.attribute.value(1961,)
15 x 15 cm, Ceramic Platform
product.attribute(14,) product.attribute.value(1962,)
6" x 6", Stainless Steel platform
product.attribute(14,) product.attribute.value(1965,)
Ear Protection must be worn area; 300x100mm
product.attribute(14,) product.attribute.value(1972,)
Dangerous Chemicals, 300x200mm
product.attribute(14,) product.attribute.value(1973,)
Harmful Substance, 200x300mm
product.attribute(14,) product.attribute.value(1974,)
Pesticide, 200x300mm
product.attribute(14,) product.attribute.value(1975,)
Flamable Liquid, 200x300mm
product.attribute(14,) product.attribute.value(1976,)
Dangerous when wet, 200x300mm
product.attribute(14,) product.attribute.value(1977,)
Oxidizing agent, 200x300mm
product.attribute(14,) product.attribute.value(1978,)
Corosive, 200x300mm
product.attribute(14,) product.attribute.value(2107,)
AB-1 Balanced Ciders (Saccharomyces Bayanus)
product.attribute(14,) product.attribute.value(2108,)
AS-2 Sweet Ciders (Saccharomyces Cerevisiae)
product.attribute(14,) product.attribute.value(2109,)
AC-4 Crisp Ciders (Saccharomyces Bayanus)
product.attribute(14,) product.attribute.value(2110,)
TF-6 Fruity Ciders (Saccharomyces Cerevisiae)
product.attribute(14,) product.attribute.value(2112,)
Pipette Carousel 2 with holders for 6 Eppendorf Research®, Eppendorf Research® plus, Eppendorf Reference®, Eppendorf Reference® 2 or Biomaster® Pipettes
product.attribute(14,) product.attribute.value(2113,)
Charger Stand 2 for one Eppendorf Xplorer®/Xplorer® plus
product.attribute(14,) product.attribute.value(2114,)
Charger Stand 2 for one Multipette® E3/E3x or Multipette® stream/Xstream
product.attribute(14,) product.attribute.value(2115,)
Pipette Stand 2 for one Multipette® M4 without charging functionality
product.attribute(14,) product.attribute.value(2116,)
Charger Carousel 2 with charger shells for 6 Eppendorf Xplorer®/Xplorer® plus
product.attribute(14,) product.attribute.value(2144,)
4 L/h, single distilled model
product.attribute(14,) product.attribute.value(2145,)
4 L/h, Double distilled model
product.attribute(14,) product.attribute.value(2146,)
8 L/h, single distilled model
product.attribute(14,) product.attribute.value(2147,) product.attribute(14,) product.attribute.value(2230,)
Thermoblock for 24×0.5 mL reaction vessels
product.attribute(14,) product.attribute.value(2231,)
Thermoblock for 24×1.5 mL reaction vessels
product.attribute(14,) product.attribute.value(2232,)
Thermoblock for 24×2.0 mL reaction vessels
product.attribute(14,) product.attribute.value(2233,)
Thermoblock for 8×5.0 mL Eppendorf Tubes
product.attribute(14,) product.attribute.value(2234,)
Thermoblock for 8×15 mL conical tubes
product.attribute(14,) product.attribute.value(2235,)
Thermoblock for 4×50 mL conical tubes
product.attribute(14,) product.attribute.value(2236,)
Thermoblock for 24×11-11.9 mm Ø reaction vessels, height 30 mm -76 mm
product.attribute(14,) product.attribute.value(2237,)
Thermoblock for microplates and deepwell plates, includes lid
product.attribute(14,) product.attribute.value(2238,)
Thermoblock for Eppendorf 96/500 μl deepwell plates, includes lid
product.attribute(14,) product.attribute.value(2239,)
Thermoblock for Eppendorf 96/1000 μl deepwell plates, includes lid
product.attribute(14,) product.attribute.value(2240,)
Thermoblock for 96-well PCR plates, includes lid
product.attribute(14,) product.attribute.value(2241,)
Thermoblock for 384-well PCR plates, includes lid
product.attribute(14,) product.attribute.value(2242,)
Thermoblock for 24 cryo tubes, 1.5 - 2 mL, max. external diameter 12.5 mm, all base designs
product.attribute(14,) product.attribute.value(2438,) product.attribute(14,) product.attribute.value(2457,)
pH: 6.5, 100mL
product.attribute(14,) product.attribute.value(2458,)
pH: 6.5, 250mL
product.attribute(14,) product.attribute.value(2459,)
pH: 7.5, 100mL
product.attribute(14,) product.attribute.value(2460,)
pH: 7.5, 250mL
product.attribute(14,) product.attribute.value(2461,)
pH: 7.0, 100mL
product.attribute(14,) product.attribute.value(2462,)
pH: 7.0, 250mL
product.attribute(14,) product.attribute.value(2469,)
13 x 75 mm, 2.0 mL, Sodium Fluoride 3 mg, Na2EDTA 6 mg
product.attribute(14,) product.attribute.value(2470,)
13 x 75 mm, 2.0 mL, Sodium Fluoride 5 mg, Potassium Oxalate 4 mg
product.attribute(14,) product.attribute.value(2471,) product.attribute(14,) product.attribute.value(2472,)
13 x 75 mm, 4.0 mL, Hemogard™ Closure, Sodium Fluoride 10 mg, Potassium Oxalate 8 mg
product.attribute(14,) product.attribute.value(2473,)
13 x 100 mm, 6.0 mL, Hemogard™ Closure, Sodium Fluoride 15 mg, Potassium Oxalate 12 mg
product.attribute(14,) product.attribute.value(2657,)
multiSUB mini with 7 x 10cm Gel trays
product.attribute(14,) product.attribute.value(2658,)
multiSUB mini with 7 x 7cm Gel trays
product.attribute(14,) product.attribute.value(2659,)
multiSUB mini with 7 x 7cm & 7 x 10cm Gel trays
product.attribute(14,) product.attribute.value(2771,)
With standard measurement tip
product.attribute(14,) product.attribute.value(2772,)
With frozen food measurement tip
product.attribute(14,) product.attribute.value(2857,) product.attribute(14,) product.attribute.value(2858,) product.attribute(14,) product.attribute.value(2859,) product.attribute(14,) product.attribute.value(2860,) product.attribute(14,) product.attribute.value(3188,)
22 mm x 0.22 mm Siliconized circle cover slides, 120/pk
product.attribute(14,) product.attribute.value(3189,)
22 mm x 0.22 mm Siliconized circle cover slides, 1200/pk
product.attribute(14,) product.attribute.value(3190,)
22 mm x 0.96 mm Thick Siliconized circle cover slides, 75/pk
product.attribute(14,) product.attribute.value(3191,)
22 mm x 0.96 mm Thick Siliconized circle cover slides, 750/pk
product.attribute(14,) product.attribute.value(3192,)
22 mm x 0.22 mm Siliconized square cover slides, 100/pk
product.attribute(14,) product.attribute.value(3193,)
22 mm x 0.22 mm Siliconized square cover slides, 1000/pk
product.attribute(14,) product.attribute.value(3194,)
22mmx0.96mm Thick Siliconized square cover slides, 75/pk
product.attribute(14,) product.attribute.value(3195,)
22mmx0.96mm Thick Siliconized square cover slides, 750/pk
product.attribute(14,) product.attribute.value(3205,)
SYTO 9 Green Fluorescent Nucleic Acid Stain
product.attribute(14,) product.attribute.value(3206,)
SYTO 9 Green Fluorescent Nucleic Acid Stain, 100 µL
product.attribute(14,) product.attribute.value(3594,) product.attribute(14,) product.attribute.value(3595,) product.attribute(14,) product.attribute.value(3596,)
Crypto Stain Control, 10 Slides
product.attribute(14,) product.attribute.value(3597,)
Acid Fast Stain Control, 50 Slides
product.attribute(14,) product.attribute.value(3598,)
Gram Stain Control, 50 Slides
product.attribute(14,) product.attribute.value(3601,)
10 µL Heavy Gauge Wire Loops
product.attribute(14,) product.attribute.value(3602,)
10 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3603,)
2.5 µL Heavy Gauge Wire Loops
product.attribute(14,) product.attribute.value(3604,)
1 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3605,)
2.5 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3606,)
2 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3607,)
3.3 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3608,)
5 µL Nichrome Wire Loops
product.attribute(14,) product.attribute.value(3609,)
5 µL Heavy Gauge Wire Loops
product.attribute(14,) product.attribute.value(3824,)
Tube Holder 0.5 mL, for 24 × 0.5 mL reaction vessels
product.attribute(14,) product.attribute.value(3825,)
Tube Holder 1.5/2.0 mL for 24 × 1.5 mL or 2.0 mL reaction vessels
product.attribute(14,) product.attribute.value(3826,)
Tube Holder 5/15 mL for 8 x 5/15 mL conical tubes
product.attribute(14,) product.attribute.value(3827,)
Tube Holder 25/50 mL for 4 x 25/50 mL conical tubes
product.attribute(14,) product.attribute.value(3828,)
Tube Holder PCR 96 for 96 × 0.2 mL PCR tubes, PCR strips or 1 × 96-well PCR plate, semi-skirted or unskirted
product.attribute(14,) product.attribute.value(3904,)
High Protein
product.attribute(14,) product.attribute.value(3905,)
Low Protein
product.attribute(14,) product.attribute.value(3937,)
pkg of 25 plates, L × W 20 cm × 20 cm, glass support
product.attribute(14,) product.attribute.value(3938,)
pkg of 100 plates, L × W 2.5 cm × 7.5 cm, glass support
product.attribute(14,) product.attribute.value(3939,)
pkg of 25 plates, L × W 5 cm × 10 cm, glass support
product.attribute(14,) product.attribute.value(3940,)
pkg of 50 plates, L × W 20 cm × 10 cm, glass support
product.attribute(14,) product.attribute.value(3941,)
pkg of 200 plates, L × W 5 cm × 10 cm, glass support
product.attribute(14,) product.attribute.value(3942,)
pkg of 500 plates, L × W 2.5 cm × 7.5 cm, glass support
product.attribute(14,) product.attribute.value(3943,)
pkg of 25 plates L × W 5 cm × 20 cm, glass support
product.attribute(14,) product.attribute.value(3944,)
pkg of 100 plates L × W 5 cm × 20 cm, glass support
product.attribute(14,) product.attribute.value(3947,)
pkg of 1 roll, roll L × W 500 cm × 20 cm, aluminum support
product.attribute(14,) product.attribute.value(4042,) product.attribute(14,) product.attribute.value(4043,)
X-VIVO™ 15 with L-glutamine, gentamicin, recombinant transferrin and phenol red, 1 L
product.attribute(14,) product.attribute.value(4044,)
X-VIVO™ 10, with L-glutamine, gentamicin, and phenol red, 1 L
product.attribute(14,) product.attribute.value(4109,)
50 x 1.5/2.0 mL rotator drum
product.attribute(14,) product.attribute.value(4110,)
30 x 15 mL rotator drum
product.attribute(14,) product.attribute.value(4111,)
15 x 50 mL rotator drum
product.attribute(14,) product.attribute.value(4112,)
10 x 10/15 mL and 20 x 5/7 mL rotator drum
product.attribute(14,) product.attribute.value(4113,)
64 x diameter 14 mm tube rotator drum
product.attribute(14,) product.attribute.value(4114,)
64 x diameter 18.5 mm tube rotator drum
product.attribute(14,) product.attribute.value(4115,)
142 x diameter 17 mm tube rotator drum
product.attribute(14,) product.attribute.value(4116,)
76 x diameter 26 mm tube rotator drum
product.attribute(14,) product.attribute.value(4117,)
60 x 30 diameter mm tube rotator drum
product.attribute(14,) product.attribute.value(4238,)
TO-PRO™-3 Iodide (642/661), 1 mM Solution in DMSO
product.attribute(14,) product.attribute.value(4239,)
PO-PRO™-1 Iodide (435/455), 1 mM Solution in DMSO
product.attribute(14,) product.attribute.value(4240,)
TO-PRO™-1 Iodide (515/531), 1 mM Solution in DMSO
product.attribute(14,) product.attribute.value(4241,)
YO-PRO™-1 Iodide (491/509)
product.attribute(14,) product.attribute.value(4242,)
YO-PRO™-3 Iodide (612/631), 1 mM Solution in DMSO
product.attribute(14,) product.attribute.value(4335,)
SETA MTVM Gas oil
product.attribute(14,) product.attribute.value(4336,)
SETA MTVM Lubricating oil
product.attribute(14,) product.attribute.value(4337,)
SETA MTVM Kerosine (jet turbine fuel)
product.attribute(14,) product.attribute.value(4338,)
SETA MTVM Fuel oil
product.attribute(14,) product.attribute.value(4339,)
SETA MTVM Motor gasoline
product.attribute(14,) product.attribute.value(4340,)
Speed of Evacuation: 30 L/Min with 1 pump head, Ultimate pressure: 0.08 Mpa
product.attribute(14,) product.attribute.value(4535,)
Disinfectant Wipes (6/pk)
product.attribute(14,) product.attribute.value(4536,)
750ml Spray Bottle, 6/pk
product.attribute(14,) product.attribute.value(4537,)
1 Liter with fragrance
product.attribute(14,) product.attribute.value(4538,)
1 Liter without fragrance
product.attribute(14,) product.attribute.value(4539,)
5 Litres
product.attribute(14,) product.attribute.value(4736,)
RS232 cable for method uploads and data downloads in AQ4000/AQ4500
product.attribute(14,) product.attribute.value(4773,)
pH 10.0, Yellow, 500mL
product.attribute(14,) product.attribute.value(4774,)
pH 7.0, Green, 500mL
product.attribute(14,) product.attribute.value(4810,)
Half-Skirted, Clear, 0.2mL, 25/pk
product.attribute(14,) product.attribute.value(4811,)
Non-Skirted, Clear, 0.2mL, 10/pk
product.attribute(14,) product.attribute.value(4812,)
Non-Skirted, Clear, 0.1mL, 10/pk
product.attribute(14,) product.attribute.value(4813,)
Non-Skirted, White, 0.1mL, 10/pk
product.attribute(14,) product.attribute.value(4814,)
Non-Skirted, White, 0.2mL, 10/pk
product.attribute(14,) product.attribute.value(4815,) product.attribute(14,) product.attribute.value(4816,)
Full-Skirted, White base with clear wells, 0.1mL, 10/pk
product.attribute(14,) product.attribute.value(4817,)
Full-Skirted, White base with white wells, 0.1mL, 10/pk
product.attribute(14,) product.attribute.value(4823,)
0.1 mL, Flat-top caps, White tubes with clear caps
product.attribute(14,) product.attribute.value(4824,)
0.2 mL, Flat-top caps, Clear
product.attribute(14,) product.attribute.value(4825,)
0.1 mL, Flat-top caps, Clear tubes with clear caps
product.attribute(14,) product.attribute.value(4826,)
0.2 mL, Dome-Shaped caps, Clear tubes with clear caps
product.attribute(14,) product.attribute.value(4854,)
2.2 mL Well volume, U-Bottom, Non-Sterile, No cap, 24/bag
product.attribute(14,) product.attribute.value(4855,)
2.2 mL Well volume, U-Bottom, Sterile, No cap, 24/bag
product.attribute(14,) product.attribute.value(4856,)
2.2 mL Well volume, U-Bottom, Non-Sterile, With cap, 24/bag
product.attribute(14,) product.attribute.value(4857,)
2.2 mL Well volume, V-Bottom, Non-Sterile, No cap, 10/bag
product.attribute(14,) product.attribute.value(4858,)
2.2 mL Well volume, V-Bottom, Sterile, No cap, 10/bag
product.attribute(14,) product.attribute.value(4859,)
1.6 mL Well volume, U-Bottom, Non-Sterile, No cap, 24/bag
product.attribute(14,) product.attribute.value(4860,)
1.6 mL Well volume, U-Bottom, Sterile, No cap, 10/bag
product.attribute(14,) product.attribute.value(4861,)
1.6 mL Well volume, U-Bottom, Non-Sterile, With cap, 24/bag
product.attribute(14,) product.attribute.value(4862,)
1.0 mL Well volume, U-Bottom, Non-Sterile, No cap, 5/bag
product.attribute(14,) product.attribute.value(4863,)
1.0 mL Well volume, U-Bottom, Sterile, No cap, 24/bag
product.attribute(14,) product.attribute.value(4864,)
1.0 mL Well volume, U-Bottom, Non-Sterile, With cap, 24/bag
product.attribute(14,) product.attribute.value(4865,)
0.5 mL Well volume, V-Bottom, Sterile, No cap, 10/bag
product.attribute(14,) product.attribute.value(4866,)
0.5 mL Well volume, V-Bottom, Non-Sterile, No cap, 10/bag
product.attribute(14,) product.attribute.value(4991,)
Aluminium head for standard Ø 90 mm Petri dishes (without adapter)
product.attribute(14,) product.attribute.value(4992,)
Aluminium head and adapter for standard Ø 90 mm Petri dishes
product.attribute(14,) product.attribute.value(4993,)
Stainless steel head for standard Ø 90 mm Petri dishes (without adapter)
product.attribute(14,) product.attribute.value(4994,)
Aluminum aspirating head for Ø 55 mm contact plates
product.attribute(14,) product.attribute.value(4995,)
Stainless steel aspirating head for Ø 55 mm contact plates
product.attribute(14,) product.attribute.value(4996,)
Sterile heads for Ø 90 mm Petri dishes, 40/pk
product.attribute(14,) product.attribute.value(4997,)
Sterile heads for Ø 55 mm contact plates, 40/pk
product.attribute(14,) product.attribute.value(5006,)
75ft cable length, Standard Weight, Standard Markers
product.attribute(14,) product.attribute.value(5007,)
75ft cable length, Extra Weight, Standard Markers
product.attribute(14,) product.attribute.value(5008,)
75ft cable length, Asphalt Weight, Standard Markers
product.attribute(14,) product.attribute.value(5009,)
25 Meter cable length, Extra Weight, Metric Markers
product.attribute(14,) product.attribute.value(5010,)
25 Meter cable length, Standard Weight, Metric Markers
product.attribute(14,) product.attribute.value(5261,)
UV to white light converter screen, 305×330 mm
product.attribute(14,) product.attribute.value(5262,)
UV to blue light conversion screen 250×300 mm
product.attribute(14,) product.attribute.value(5283,)
with VisiCam P6 camera and adapter
product.attribute(14,) product.attribute.value(5284,)
Without Camera
product.attribute(14,) product.attribute.value(5907,)
Snap cap with conical bottom
product.attribute(14,) product.attribute.value(5908,)
Screw cap with conical bottom
product.attribute(14,) product.attribute.value(5909,)
Snap cap, self-standing
product.attribute(14,) product.attribute.value(6061,)
Bottle, no swab, 100 mL x 1
product.attribute(14,) product.attribute.value(6062,)
Tube, 2 mL with 1 sterile Dacron swab, 50/pk
product.attribute(14,) product.attribute.value(6063,)
Tube, 2 mL with 1 sterile Rayon swab, 50/pk
product.attribute(14,) product.attribute.value(6064,)
Tube, 2 mL with 1 sterile Nylon microfiber swab, 50/pk
product.attribute(14,) product.attribute.value(6065,)
Tube, 2 mL with 2 sterile Dacron swabs, 50/pk
product.attribute(14,) product.attribute.value(6066,)
Tube, 16.5×57 mm, 2 mL without swab, 50/pk
product.attribute(14,) product.attribute.value(6067,)
Tube, 16×100 mm, 2 mL with 1 sterile mini-tip flocked swab, 50/pk
product.attribute(14,) product.attribute.value(6068,)
Tube, 16×100 mm, 2 mL with 1 sterile Nylon microfiber swab, 50/pk
product.attribute(14,) product.attribute.value(6069,)
Tube, 16.5×57 mm, 2 mL with 2 sterile Rayon swabs, 50/pk
product.attribute(14,) product.attribute.value(6070,)
Tube, 16×100 mm, 2 mL with 2 sterile swabs (Nylon microfiber, mini-tip flocked), 50/pk
product.attribute(14,) product.attribute.value(6071,)
Tube, 16×100 mm, 2 mL VTM with 2 sterile swabs (Nylon microfiber, Rayon), 50/pk
product.attribute(14,) product.attribute.value(6072,)
Tube, 16×100 mm, 3 mL VTM with 2 swabs (Nylon microfiber, Rayon), 50/pk
product.attribute(14,) product.attribute.value(6073,)
Tube, 16.5×57 mm, 3 mL VTM with 1 sterile Nylon microfiber swab, 50/pk
product.attribute(14,) product.attribute.value(6074,)
Tube, 16×100 mm, 3 mL VTM with 1 sterile Nylon microfiber swab, 50/pk
product.attribute(14,) product.attribute.value(6075,)
Tube, 16×100 mm, 3 mL VTM, No swab included, 50/pk
product.attribute(14,) product.attribute.value(6076,)
Tube, 16.5×57 mm, 3 mL VTM, No swab included, 50/pk
product.attribute(14,) product.attribute.value(6077,)
Tube, 16×100 mm, 1 mL VTM with Saliva collection device, 50/pk
product.attribute(14,) product.attribute.value(6853,)
LS Columns, 25/pk
product.attribute(14,) product.attribute.value(6854,)
25 pack LS Columns plus 75 pack Tubes
product.attribute(14,) product.attribute.value(6869,)
300µl, box of 960 Tips
product.attribute(14,) product.attribute.value(7018,)
500 mg bed weight, 10 mL Cartridge, 50 Pk
Wavelenght
product.attribute(82,) product.attribute.value(1453,)
254nm
product.attribute(82,) product.attribute.value(1454,)
365nm
product.attribute(82,) product.attribute.value(1530,)
302 nm
product.attribute(82,) product.attribute.value(4426,)
492 nm for General Terbium measurement
product.attribute(82,) product.attribute.value(4427,)
520 nm for LanthaScreen measurement of Tb acceptor; HTRF donor measurement of TbGreen
product.attribute(82,) product.attribute.value(4428,)
620 nm for General Europium measurement; LanthaScreen measurement of Eu donor; HTRF acceptor measurement of TbGreen; HTRF donor measurement of EuRed and TbRed
product.attribute(82,) product.attribute.value(4429,)
665 nm for LanthaScreen measurement of Eu acceptor; HTRF acceptor measurement of EuRed and TbRed
20
per Page
20
40
60
View All Products
hyg
spect
Fruits & Vegetables
Sale
Pro-Lab Prolex™ Blue Staph Latex Kit for 100 tests
Pro-Lab Prolex™ Blue Staph Latex Kit for 100 tests
Pro-Lab Prolex™ Blue Staph Latex Kit for 100 tests
(0)
Sign In to View Price
Sale
For a blood-free selective medium for the isolation of Campylobacter jejuni and Campylobacter coli when incubated at 42° C. Each vial for 500mL medium
Thermo Scientific™ Oxoid™ Modified Karmali Selective Supplement
Thermo Scientific™ Oxoid™ Modified Karmali Selective Supplement
Thermo Scientific™ Oxoid™ Modified Karmali Selective Supplement
(0)
Sign In to View Price
Sale
Thermo Scientific™ Oxoid™ Campylobacter Karmali Agar Base (Dehydrated)
Thermo Scientific™ Oxoid™ Campylobacter Karmali Agar Base (Dehydrated)
Thermo Scientific™ Oxoid™ Campylobacter Karmali Agar Base (Dehydrated)
(0)
Sign In to View Price
Sale
Traceable to SRM from NIST
Manufactured and tested in ISO Guide 34/ ISO17025 accredited facilities
Supplied with certificate of analysis, real value ±0.3%
VWR Magnesium standard solution, 1000 mg/L Mg in dil. nitric acid AVS TITRINORM standard for AAS
VWR Magnesium standard solution, 1000 mg/L Mg in dil. nitric acid AVS TITRINORM standard for AAS
VWR Magnesium standard solution, 1000 mg/L Mg in dil. nitric acid AVS TITRINORM standard for AAS
(0)
Sign In to View Price
Sale
Traceable to SRM from NIST
Manufactured and tested in ISO Guide 34/ ISO17025 accredited facilities
Supplied with certificate of analysis, real value ±0,3%
VWR Gold standard solution, 1,000 mg/L Au in 2% hydrochloric acid AVS TITRINORM standard for AAS
VWR Gold standard solution, 1,000 mg/L Au in 2% hydrochloric acid AVS TITRINORM standard for AAS
VWR Gold standard solution, 1,000 mg/L Au in 2% hydrochloric acid AVS TITRINORM standard for AAS
(0)
Sign In to View Price
Sale
VWR Sodium gluconate, technical grade
VWR Sodium gluconate, technical grade
VWR Sodium gluconate, technical grade
(0)
Sign In to View Price
Sale
Biological buffer - useful range 5.5 - 6.7.
Heavy metals: <15ppm
pKa @ 20°C: 6.15 + 0.1
Formula: C₆H₁₃NO₄S
CAS Number: 4432-31-9
Apollo Sci. β-(N-Morpholino)ethanesulphonic acid (MES) ≥99.5%, Ultrapure
Apollo Sci. β-(N-Morpholino)ethanesulphonic acid (MES) ≥99.5%, Ultrapure
Apollo Sci. β-(N-Morpholino)ethanesulphonic acid (MES) ≥99.5%, Ultrapure
(0)
Sign In to View Price
Sale
VWR D-(-)-Mannitol analytical reagent
VWR D-(-)-Mannitol analytical reagent
VWR D-(-)-Mannitol analytical reagent
(0)
Sign In to View Price
Sale
Kit Content
-500 polycarbonate screen membrane filters (13 mm diameter, 20 µm pore size)
- 5 plastic Swinnex filter holders (13 mm)
- 2 syringes (10 cc)
- Forceps
- Convenient plastic case
Sterlitech Schistosome Test Kit
Sterlitech Schistosome Test Kit
Sterlitech Schistosome Test Kit
(0)
Sign In to View Price
Sale
Vial+Cap+Septa are pre-assembled together
Size: 15.5x101 mm
12mL Gas Sampling Vial, White Open Top Screw Cap with Butyl Septa, Flat Bottom, Coated Vial, Evacuated
12mL Gas Sampling Vial, White Open Top Screw Cap with Butyl Septa, Flat Bottom, Coated Vial, Evacuated
12mL Gas Sampling Vial, White Open Top Screw Cap with Butyl Septa, Flat Bottom, Coated Vial, Evacuated
(0)
Sign In to View Price
Sale
CTK OnSite® H. pylori Ag Rapid Test CE, Stool
CTK OnSite® H. pylori Ag Rapid Test CE, Stool
CTK OnSite® H. pylori Ag Rapid Test CE, Stool
(0)
Sign In to View Price
Sale
VWR Ammonium chloride ≥99%, GPR RECTAPUR®
VWR Ammonium chloride ≥99%, GPR RECTAPUR®
VWR Ammonium chloride ≥99%, GPR RECTAPUR®
(0)
Sign In to View Price
Sale
Safety cut-off (when in darkroom)
VWR® UV transilluminator for imager systems, 200×200 mm
VWR® UV transilluminator for imager systems, 200×200 mm
VWR® UV transilluminator for imager systems, 200×200 mm
(0)
Sign In to View Price
Sale
VWR® Light Conversion Screen for UV Transilluminators and Gel Documentation systems
VWR® Light Conversion Screen for UV Transilluminators and Gel Documentation systems
VWR® Light Conversion Screen for UV Transilluminators and Gel Documentation systems
(0)
Sign In to View Price
Sale
Camera: 5.4 MP image resolution
Lens: f1.8
Light Sources: Epi White, Dual wavelength transillumination at 302 nm
Field of View: 15 cm x 20 cm
Cabinet: • Door sensor to prevent accidental exposure to UV; automatically shuts off the UV light when the door is open; • Safety override, enabling band cutting on the UV transilluminator with automatic turn off after 5 minutes
Emission Filter: 590 nm
3-position Filter Slider: No
Product Footprint: 12 (30.48 cm x 38.1 cm)
Axygen® Gel documentation system without PC
Axygen® Gel documentation system without PC
Axygen® Gel documentation system without PC
(0)
Sign In to View Price
Sale
Camera: 5.4 MP image resolution
Lens: f1.8
Light Sources: Epi White, Dual wavelength transillumination at 302 nm
Field of View: 15 cm x 20 cm
Cabinet: • Door sensor to prevent accidental exposure to UV; automatically shuts off the UV light when the door is open; • Safety override, enabling band cutting on the UV transilluminator with automatic turn off after 5 minutes
Emission Filter: 590 nm
3-position Filter Slider: Yes
Product Footprint: 12 (30.48 cm x 38.1 cm)
Axygen® Gel documentation system with Windows 8 tablet computer
Axygen® Gel documentation system with Windows 8 tablet computer
Axygen® Gel documentation system with Windows 8 tablet computer
(0)
Sign In to View Price
Sale
For 96 (8×12) microtubes with 0.5 ml capacity or 96 microtubes with 1.5/2 ml capacity
VWR® Racks for Microtubes, 96 places with lid
VWR® Racks for Microtubes, 96 places with lid
VWR® Racks for Microtubes, 96 places with lid
(0)
Sign In to View Price
Sale
Specifications: SpO2 and pulse rate measurement
EDAN Handheld Pulse Oximeter
EDAN Handheld Pulse Oximeter
EDAN Handheld Pulse Oximeter
(0)
Sign In to View Price
Sale
High-sensitivity interchangeable probe
Supports 2MHZ,3MHZ,4MHZ, 5MHZ, 8MHZ waterproof probes
Real-time automatic and manual FHR
Long-time continuous use (about 8h)
EDAN Sonotrax Basic A Fetal Doppler
EDAN Sonotrax Basic A Fetal Doppler
EDAN Sonotrax Basic A Fetal Doppler
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: TGCCGACTACAAGCGAATTACTG
Reverse Sequence: CTGCTTGTCCAGATGACTTCGG
PD-L1 (CD274) Human qPCR Primer Pair (NM_014143), for 200 reactions
PD-L1 (CD274) Human qPCR Primer Pair (NM_014143), for 200 reactions
PD-L1 (CD274) Human qPCR Primer Pair (NM_014143), for 200 reactions
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: GCAGTGTACTTCACAGAGCTGTC
Reverse Sequence: AAGCCAAAGGCTCCAGTCACCA
Lymphocyte Activation Gene 3 (LAG3) Human qPCR Primer Pair (NM_002286)
Lymphocyte Activation Gene 3 (LAG3) Human qPCR Primer Pair (NM_002286)
Lymphocyte Activation Gene 3 (LAG3) Human qPCR Primer Pair (NM_002286)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: GACTCTAGCAGACAGTGGGATC
Reverse Sequence: GGTGGTAAGCATCCTTGGAAAGG
TIM 3 (HAVCR2) Human qPCR Primer Pair (NM_032782)
TIM 3 (HAVCR2) Human qPCR Primer Pair (NM_032782)
TIM 3 (HAVCR2) Human qPCR Primer Pair (NM_032782)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: TCTACTGCCTGGAGGTCACCAG
Reverse Sequence: GACCAAGCAAGACAGAGCCACT
CD244 Human qPCR Primer Pair (NM_016382)
CD244 Human qPCR Primer Pair (NM_016382)
CD244 Human qPCR Primer Pair (NM_016382)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: ACGGGACTCTACATCTGCAAGG
Reverse Sequence: GGAGGAAGTCAGAATCTGGGCA
CTLA4 Human qPCR Primer Pair (NM_005214)
CTLA4 Human qPCR Primer Pair (NM_005214)
CTLA4 Human qPCR Primer Pair (NM_005214)
(0)
Sign In to View Price
Sale
1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Forward Sequence: GAAAGAGTGGCAACCTGCCTTC
Reverse Sequence: GCACCAAGTTTTACTACATCTGCC
Ki67 (MKI67) Human qPCR Primer Pair (NM_002417)
Ki67 (MKI67) Human qPCR Primer Pair (NM_002417)
Ki67 (MKI67) Human qPCR Primer Pair (NM_002417)
(0)
Sign In to View Price
Showing 25 Of 7324
70
71
72
73
74
我们使用cookies为您提供在这网站上更好的用户体验。
Cookie 政策
只有必需品
同意