Thermo Scientific Applied Biosystems™ TaqMan™ Advanced miRNA Assay, 250 Reactions
Catalog No :
CAS Number :
Brand :
In Stock
Assay Name: hsa-miR-4725-5p
Mature miRNA Sequence: AGACCCUGCAGCCUUCCCACC
Species: Human
Specifications:
Application | qPCR |
Storage Temperature | -15°C to -25°C |
Product Type | PCR Reagent |
Product Brand | Thermo Fisher Scientific™ |
Product Grade | Molecular Biology |
Applied Biosystems TaqMan Advanced miRNA Assays enable highly sensitive and specific quantification of mature miRNAs using qPCR. Together with the TaqMan Advanced miRNA cDNA Synthesis Kit, this solution provides a streamlined upfront workflow that is ideal for analysis of multiple miRNA targets from a single sample or low-level RNA samples such as serum and plasma.
• Universal RT—one RT step for all TaqMan Advanced miRNA Assays
• Sensitivity—detect as few as 60 copies input into cDNA synthesis
• Specificity—detect only the mature miRNA and distinguish between highly homologous targets
• Small sample input—detect and quantify mature miRNA from as little as 1 pg total RNA or 2 μL plasma
• Compatibility with biofluids including human serum, plasma, and tissue
Pre-formulated assay
• 2 unlabeled PCR primers (900 nM each final 1X concentration)
• 1 FAM dye-labeled TaqMan MGB probe (250 nM final 1X concentration)
TaqMan miRNA Assay selection guide
TaqMan MicroRNA Assays
Description: TaqMan MicroRNA Assays employ a novel target-specific stem–loop primer during cDNA synthesis to produce a template for real-time PCR
RT chemistry: miRNA-specific RT
Throughput: Best for 1–10 targets
Coverage: 205 species available, coverage for miRBase v.21
TaqMan Advanced miRNA Assays
Description: TaqMan Advanced miRNA Assays employ a universal RT step for a streamlined workflow, and a universal miR-Amp step to enable highly sensitive detection by real-time PCR
RT chemistry: Universal RT
Throughput: Best for > 10 targets
Coverage: All human, mouse, and rat miRNAs; coverage for miRBase v.21