Thermo Scientific Applied Biosystems™ TaqMan™ Advanced miRNA Assay, 250 Reactions

Catalog No :

CAS Number :

Brand :

Availability :

In Stock

Assay Name: hsa-miR-4725-5p
Mature miRNA Sequence: AGACCCUGCAGCCUUCCCACC
Species: Human

Termini e condizioni
Garanzia di rimborso di 30 giorni
Spedizione: 2-3 giorni lavorativi

    This combination does not exist.

    Place Inquiry

    This combination does not exist.

    Specifications:
    Application qPCR
    Storage Temperature -15°C to -25°C
    Product Type PCR Reagent
    Product Brand Thermo Fisher Scientific™
    Product Grade Molecular Biology

    Applied Biosystems TaqMan Advanced miRNA Assays enable highly sensitive and specific quantification of mature miRNAs using qPCR. Together with the TaqMan Advanced miRNA cDNA Synthesis Kit, this solution provides a streamlined upfront workflow that is ideal for analysis of multiple miRNA targets from a single sample or low-level RNA samples such as serum and plasma.


    • Universal RT—one RT step for all TaqMan Advanced miRNA Assays

    • Sensitivity—detect as few as 60 copies input into cDNA synthesis

    • Specificity—detect only the mature miRNA and distinguish between highly homologous targets

    • Small sample input—detect and quantify mature miRNA from as little as 1 pg total RNA or 2 μL plasma

    • Compatibility with biofluids including human serum, plasma, and tissue


    Pre-formulated assay

    • 2 unlabeled PCR primers (900 nM each final 1X concentration)

    • 1 FAM dye-labeled TaqMan MGB probe (250 nM final 1X concentration)


    TaqMan miRNA Assay selection guide


    TaqMan MicroRNA Assays

    Description: TaqMan MicroRNA Assays employ a novel target-specific stem–loop primer during cDNA synthesis to produce a template for real-time PCR

    RT chemistry: miRNA-specific RT

    Throughput: Best for 1–10 targets

    Coverage: 205 species available, coverage for miRBase v.21


    TaqMan Advanced miRNA Assays

    Description: TaqMan Advanced miRNA Assays employ a universal RT step for a streamlined workflow, and a universal miR-Amp step to enable highly sensitive detection by real-time PCR

    RT chemistry: Universal RT

    Throughput: Best for > 10 targets

    Coverage: All human, mouse, and rat miRNAs; coverage for miRBase v.21

    Product Specification not found.

    Accessory Products


    Add a Review

    Rate this Product  
    Name *
    Email *

    Your Review *
    17473





    0

    0  Reviews
    (0) 
    (0) 
    (0) 
    (0) 
    (0) 

    Customer Review